Incidental Mutation 'R1873:Cyth3'
ID 210929
Institutional Source Beutler Lab
Gene Symbol Cyth3
Ensembl Gene ENSMUSG00000018001
Gene Name cytohesin 3
Synonyms Pscd3, Grp1, cytohesin 3
MMRRC Submission 039895-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.151) question?
Stock # R1873 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 143608202-143696005 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 143683516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 138 (H138Q)
Ref Sequence ENSEMBL: ENSMUSP00000112157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110727] [ENSMUST00000116456]
AlphaFold O08967
PDB Structure GRP1 PH DOMAIN WITH INS(1,3,4,5)P4 [X-RAY DIFFRACTION]
GRP1 PH DOMAIN (UNLIGANDED) [X-RAY DIFFRACTION]
Structure of the pleckstrin homology domain from GRP1 in complex with inositol(1,3,4,5,6)pentakisphosphate [X-RAY DIFFRACTION]
Structure of the pleckstrin homology domain from GRP1 in complex with inositol 1,3,4,5-tetrakisphosphate [X-RAY DIFFRACTION]
Triglycine variant of the Grp1 Pleckstrin Homology Domain unliganded [X-RAY DIFFRACTION]
Crystal Structure of Autoinhibited Form of Grp1 Arf GTPase Exchange Factor [X-RAY DIFFRACTION]
Crystal Structure of Autoinhibited Form of Grp1 Arf GTPase Exchange Factor [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110727
AA Change: H90Q

PolyPhen 2 Score 0.487 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106355
Gene: ENSMUSG00000018001
AA Change: H90Q

DomainStartEndE-ValueType
Sec7 15 200 1.5e-106 SMART
PH 217 334 1.1e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000116456
AA Change: H138Q

PolyPhen 2 Score 0.542 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112157
Gene: ENSMUSG00000018001
AA Change: H138Q

DomainStartEndE-ValueType
low complexity region 3 10 N/A INTRINSIC
low complexity region 14 35 N/A INTRINSIC
Sec7 63 248 3.21e-104 SMART
PH 265 382 2.36e-24 SMART
Meta Mutation Damage Score 0.5645 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the PSCD (pleckstrin homology, Sec7 and coiled-coil domains) family. PSCD family members have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein (GEP) activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This encoded protein is involved in the control of Golgi structure and function, and it may have a physiological role in regulating ADP-ribosylation factor protein 6 (ARF) functions, in addition to acting on ARF1. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,870,781 (GRCm39) I124L probably benign Het
Abi3bp A G 16: 56,394,862 (GRCm39) Y190C probably damaging Het
Adam34 A C 8: 44,104,843 (GRCm39) N267K probably benign Het
Anxa5 T C 3: 36,503,551 (GRCm39) D301G probably damaging Het
Atf7ip G T 6: 136,536,886 (GRCm39) D40Y probably damaging Het
Cacna2d2 T G 9: 107,391,071 (GRCm39) M400R probably damaging Het
Cd96 C A 16: 45,938,335 (GRCm39) L43F probably damaging Het
Cep120 T C 18: 53,871,560 (GRCm39) E104G probably damaging Het
Cfap221 T C 1: 119,881,389 (GRCm39) I358V probably benign Het
Cfhr4 C T 1: 139,702,398 (GRCm39) E29K probably damaging Het
Chil4 C T 3: 106,113,414 (GRCm39) E168K probably benign Het
Clca3a1 A G 3: 144,452,590 (GRCm39) V631A probably damaging Het
Cluh C T 11: 74,552,902 (GRCm39) A649V possibly damaging Het
Commd9 A G 2: 101,727,502 (GRCm39) T99A probably benign Het
Csgalnact1 T C 8: 68,854,036 (GRCm39) N255S probably benign Het
Dnah7a A T 1: 53,495,691 (GRCm39) probably benign Het
Fbxl18 G A 5: 142,871,978 (GRCm39) A419V probably damaging Het
Fyco1 A G 9: 123,652,303 (GRCm39) V1135A probably benign Het
Glcci1 C A 6: 8,537,837 (GRCm39) H152N probably benign Het
Gm10477 T A X: 55,570,127 (GRCm39) F9Y probably damaging Het
Gnrhr A G 5: 86,330,060 (GRCm39) L320P probably damaging Het
Gorasp1 A T 9: 119,759,306 (GRCm39) S138T probably benign Het
Hars1 C A 18: 36,900,294 (GRCm39) Q469H probably damaging Het
Homer2 T C 7: 81,286,111 (GRCm39) K34E probably damaging Het
Hscb T C 5: 110,978,823 (GRCm39) I198V probably benign Het
Kat6b T C 14: 21,567,057 (GRCm39) S39P probably damaging Het
Kcnk12 G T 17: 88,053,499 (GRCm39) Q388K probably damaging Het
Kcnq3 A G 15: 65,874,104 (GRCm39) I548T probably benign Het
Mark2 A G 19: 7,261,880 (GRCm39) Y351H probably damaging Het
Masp2 A T 4: 148,698,952 (GRCm39) I678F probably damaging Het
Mc4r A T 18: 66,992,531 (GRCm39) I194N probably damaging Het
Ms4a6d A G 19: 11,579,223 (GRCm39) S85P probably damaging Het
Myh4 T A 11: 67,145,569 (GRCm39) Y1351N probably benign Het
Myo16 A G 8: 10,322,789 (GRCm39) D73G probably damaging Het
Mzt1 C T 14: 99,278,097 (GRCm39) probably null Het
Nalcn G A 14: 123,521,013 (GRCm39) H1631Y probably benign Het
Ncf2 A G 1: 152,701,661 (GRCm39) N213S probably benign Het
Nf1 C A 11: 79,437,987 (GRCm39) T99K probably damaging Het
Nsf T C 11: 103,749,843 (GRCm39) S547G probably damaging Het
Ntrk3 T A 7: 78,112,587 (GRCm39) I190F probably benign Het
Obsl1 T C 1: 75,474,877 (GRCm39) Y841C probably damaging Het
Ogdh A T 11: 6,290,438 (GRCm39) probably benign Het
Or2ag12 T A 7: 106,277,691 (GRCm39) M1L probably damaging Het
Or5b12 C T 19: 12,896,852 (GRCm39) V274M probably damaging Het
Otog G A 7: 45,918,767 (GRCm39) V948I probably damaging Het
Plekhm1 T C 11: 103,264,824 (GRCm39) D880G probably benign Het
Pnliprp2 G T 19: 58,751,821 (GRCm39) V189L probably benign Het
Polg A G 7: 79,106,241 (GRCm39) L678S probably benign Het
Ptprm C T 17: 66,995,350 (GRCm39) V1293I probably damaging Het
Pwwp3a T A 10: 80,068,442 (GRCm39) D195E possibly damaging Het
Rhou A T 8: 124,387,990 (GRCm39) R241W probably damaging Het
Rtn4 A T 11: 29,686,437 (GRCm39) N264I probably damaging Het
Sez6l T C 5: 112,621,276 (GRCm39) probably benign Het
Sost T C 11: 101,855,069 (GRCm39) E80G probably damaging Het
Spag16 C T 1: 69,935,744 (GRCm39) probably benign Het
Speer4f2 A T 5: 17,579,447 (GRCm39) N82I probably damaging Het
Spef2 C T 15: 9,584,194 (GRCm39) E1624K probably damaging Het
Taf1b T A 12: 24,606,668 (GRCm39) L496Q possibly damaging Het
Tarbp1 A G 8: 127,173,786 (GRCm39) I976T probably damaging Het
Tex14 T A 11: 87,390,431 (GRCm39) V376D probably damaging Het
Timm21 G C 18: 84,967,387 (GRCm39) L130V probably damaging Het
Tm9sf1 T C 14: 55,873,680 (GRCm39) D606G probably damaging Het
Tmc2 A C 2: 130,090,676 (GRCm39) N674T possibly damaging Het
Top3a C A 11: 60,638,810 (GRCm39) E562* probably null Het
Umodl1 A T 17: 31,201,238 (GRCm39) D389V probably damaging Het
Uso1 T C 5: 92,340,718 (GRCm39) probably benign Het
Vmn1r205 A G 13: 22,776,223 (GRCm39) V293A possibly damaging Het
Vmn2r107 A G 17: 20,565,840 (GRCm39) T52A probably benign Het
Vmn2r4 C T 3: 64,298,479 (GRCm39) V461I possibly damaging Het
Vmn2r99 A T 17: 19,582,415 (GRCm39) I7F probably benign Het
Vps11 A G 9: 44,271,233 (GRCm39) F80S probably damaging Het
Wdr43 A G 17: 71,940,647 (GRCm39) S258G probably benign Het
Zbtb24 A G 10: 41,327,123 (GRCm39) D3G probably benign Het
Zc3hav1 C T 6: 38,309,692 (GRCm39) V377I possibly damaging Het
Zfp668 T C 7: 127,465,654 (GRCm39) probably null Het
Other mutations in Cyth3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Cyth3 APN 5 143,692,920 (GRCm39) splice site probably null
IGL01340:Cyth3 APN 5 143,670,190 (GRCm39) nonsense probably null
IGL01372:Cyth3 APN 5 143,678,393 (GRCm39) missense possibly damaging 0.93
IGL02092:Cyth3 APN 5 143,693,140 (GRCm39) splice site probably benign
IGL02850:Cyth3 APN 5 143,672,259 (GRCm39) missense probably damaging 0.97
IGL02892:Cyth3 APN 5 143,693,192 (GRCm39) missense possibly damaging 0.86
R0373:Cyth3 UTSW 5 143,670,181 (GRCm39) utr 5 prime probably benign
R0726:Cyth3 UTSW 5 143,678,397 (GRCm39) missense probably benign 0.00
R1217:Cyth3 UTSW 5 143,688,575 (GRCm39) missense probably damaging 1.00
R1552:Cyth3 UTSW 5 143,683,505 (GRCm39) missense probably benign 0.12
R1623:Cyth3 UTSW 5 143,687,127 (GRCm39) missense probably damaging 1.00
R3788:Cyth3 UTSW 5 143,622,298 (GRCm39) intron probably benign
R4736:Cyth3 UTSW 5 143,670,234 (GRCm39) critical splice donor site probably null
R6500:Cyth3 UTSW 5 143,693,595 (GRCm39) missense probably damaging 0.97
R6824:Cyth3 UTSW 5 143,672,265 (GRCm39) missense probably damaging 1.00
R7105:Cyth3 UTSW 5 143,693,027 (GRCm39) missense probably benign 0.07
R7143:Cyth3 UTSW 5 143,670,151 (GRCm39) missense unknown
R7767:Cyth3 UTSW 5 143,693,229 (GRCm39) missense probably damaging 1.00
R7839:Cyth3 UTSW 5 143,683,509 (GRCm39) missense probably benign 0.01
R8220:Cyth3 UTSW 5 143,687,344 (GRCm39) splice site probably null
R8497:Cyth3 UTSW 5 143,678,328 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTTACAGTGAAGACATGGTTGCTTG -3'
(R):5'- CCCTGAGTGAGTCTGCTTTC -3'

Sequencing Primer
(F):5'- AAGACATGGTTGCTTGTTGTCAGC -3'
(R):5'- CTGCCTAGGACTGCTAAGTGTCAC -3'
Posted On 2014-06-30