Incidental Mutation 'R1873:Cluh'
ID210959
Institutional Source Beutler Lab
Gene Symbol Cluh
Ensembl Gene ENSMUSG00000020741
Gene Nameclustered mitochondria (cluA/CLU1) homolog
Synonyms1300001I01Rik
MMRRC Submission 039895-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.565) question?
Stock #R1873 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location74649495-74670847 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74662076 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 649 (A649V)
Ref Sequence ENSEMBL: ENSMUSP00000090593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092915] [ENSMUST00000117818]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092915
AA Change: A649V

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000090593
Gene: ENSMUSG00000020741
AA Change: A649V

DomainStartEndE-ValueType
Pfam:CLU_N 104 177 3.1e-28 PFAM
Pfam:CLU 394 614 3.4e-89 PFAM
Pfam:eIF3_p135 806 988 1.3e-58 PFAM
Pfam:TPR_10 1059 1100 2.9e-7 PFAM
low complexity region 1114 1125 N/A INTRINSIC
Pfam:TPR_12 1140 1218 1.7e-10 PFAM
low complexity region 1316 1334 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000117818
AA Change: A649V

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113371
Gene: ENSMUSG00000020741
AA Change: A649V

DomainStartEndE-ValueType
Pfam:CLU_N 102 177 9.8e-30 PFAM
Pfam:CLU 394 615 5.3e-92 PFAM
Pfam:eIF3_p135 796 938 2.9e-38 PFAM
Pfam:TPR_10 1008 1049 9.5e-7 PFAM
low complexity region 1063 1074 N/A INTRINSIC
Pfam:TPR_12 1089 1167 1.1e-9 PFAM
low complexity region 1265 1283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127679
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155558
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 98% (82/84)
MGI Phenotype PHENOTYPE: Constitutive homozygous KO affects liver mitochondrial function and leads to neonatal lethality. Conditional homozygous KO in the adult liver affects cellular respiration under energy stress conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,979,955 I124L probably benign Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam34 A C 8: 43,651,806 N267K probably benign Het
Anxa5 T C 3: 36,449,402 D301G probably damaging Het
Atf7ip G T 6: 136,559,888 D40Y probably damaging Het
Cacna2d2 T G 9: 107,513,872 M400R probably damaging Het
Cd96 C A 16: 46,117,972 L43F probably damaging Het
Cep120 T C 18: 53,738,488 E104G probably damaging Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Chil4 C T 3: 106,206,098 E168K probably benign Het
Clca3a1 A G 3: 144,746,829 V631A probably damaging Het
Commd9 A G 2: 101,897,157 T99A probably benign Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cyth3 T A 5: 143,697,761 H138Q possibly damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fyco1 A G 9: 123,823,238 V1135A probably benign Het
Glcci1 C A 6: 8,537,837 H152N probably benign Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm4788 C T 1: 139,774,660 E29K probably damaging Het
Gnrhr A G 5: 86,182,201 L320P probably damaging Het
Gorasp1 A T 9: 119,930,240 S138T probably benign Het
Hars C A 18: 36,767,241 Q469H probably damaging Het
Homer2 T C 7: 81,636,363 K34E probably damaging Het
Hscb T C 5: 110,830,957 I198V probably benign Het
Kat6b T C 14: 21,516,989 S39P probably damaging Het
Kcnk12 G T 17: 87,746,071 Q388K probably damaging Het
Kcnq3 A G 15: 66,002,255 I548T probably benign Het
Mark2 A G 19: 7,284,515 Y351H probably damaging Het
Masp2 A T 4: 148,614,495 I678F probably damaging Het
Mc4r A T 18: 66,859,460 I194N probably damaging Het
Ms4a6d A G 19: 11,601,859 S85P probably damaging Het
Mum1 T A 10: 80,232,608 D195E possibly damaging Het
Myh4 T A 11: 67,254,743 Y1351N probably benign Het
Myo16 A G 8: 10,272,789 D73G probably damaging Het
Mzt1 C T 14: 99,040,661 probably null Het
Nalcn G A 14: 123,283,601 H1631Y probably benign Het
Ncf2 A G 1: 152,825,910 N213S probably benign Het
Nf1 C A 11: 79,547,161 T99K probably damaging Het
Nsf T C 11: 103,859,017 S547G probably damaging Het
Ntrk3 T A 7: 78,462,839 I190F probably benign Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Ogdh A T 11: 6,340,438 probably benign Het
Olfr1448 C T 19: 12,919,488 V274M probably damaging Het
Olfr693 T A 7: 106,678,484 M1L probably damaging Het
Otog G A 7: 46,269,343 V948I probably damaging Het
Plekhm1 T C 11: 103,373,998 D880G probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Polg A G 7: 79,456,493 L678S probably benign Het
Ptprm C T 17: 66,688,355 V1293I probably damaging Het
Rhou A T 8: 123,661,251 R241W probably damaging Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Sez6l T C 5: 112,473,410 probably benign Het
Sost T C 11: 101,964,243 E80G probably damaging Het
Spag16 C T 1: 69,896,585 probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Taf1b T A 12: 24,556,669 L496Q possibly damaging Het
Tarbp1 A G 8: 126,447,047 I976T probably damaging Het
Tex14 T A 11: 87,499,605 V376D probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tm9sf1 T C 14: 55,636,223 D606G probably damaging Het
Tmc2 A C 2: 130,248,756 N674T possibly damaging Het
Top3a C A 11: 60,747,984 E562* probably null Het
Umodl1 A T 17: 30,982,264 D389V probably damaging Het
Uso1 T C 5: 92,192,859 probably benign Het
Vmn1r205 A G 13: 22,592,053 V293A possibly damaging Het
Vmn2r107 A G 17: 20,345,578 T52A probably benign Het
Vmn2r4 C T 3: 64,391,058 V461I possibly damaging Het
Vmn2r99 A T 17: 19,362,153 I7F probably benign Het
Vps11 A G 9: 44,359,936 F80S probably damaging Het
Wdr43 A G 17: 71,633,652 S258G probably benign Het
Zbtb24 A G 10: 41,451,127 D3G probably benign Het
Zc3hav1 C T 6: 38,332,757 V377I possibly damaging Het
Zfp668 T C 7: 127,866,482 probably null Het
Other mutations in Cluh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cluh APN 11 74664064 missense probably benign 0.28
IGL00858:Cluh APN 11 74659605 missense possibly damaging 0.86
IGL01380:Cluh APN 11 74665946 missense probably benign 0.04
IGL02402:Cluh APN 11 74657171 missense probably damaging 1.00
IGL02620:Cluh APN 11 74665067 nonsense probably null
IGL02990:Cluh APN 11 74667765 splice site probably null
IGL03163:Cluh APN 11 74666068 missense probably benign 0.44
IGL03208:Cluh APN 11 74669506 unclassified probably null
IGL03293:Cluh APN 11 74665752 missense probably benign 0.03
IGL03408:Cluh APN 11 74665953 missense probably benign 0.06
spent UTSW 11 74660372 missense probably damaging 1.00
FR4342:Cluh UTSW 11 74669524 small insertion probably benign
FR4342:Cluh UTSW 11 74669526 small insertion probably benign
FR4449:Cluh UTSW 11 74669532 small insertion probably benign
FR4589:Cluh UTSW 11 74669531 small insertion probably benign
FR4737:Cluh UTSW 11 74669514 small insertion probably benign
FR4737:Cluh UTSW 11 74669519 small insertion probably benign
FR4737:Cluh UTSW 11 74669524 small insertion probably benign
FR4737:Cluh UTSW 11 74669533 small insertion probably benign
FR4976:Cluh UTSW 11 74669520 small insertion probably benign
R0147:Cluh UTSW 11 74665938 missense probably damaging 1.00
R0153:Cluh UTSW 11 74657350 splice site probably benign
R0506:Cluh UTSW 11 74664894 missense probably benign 0.20
R0526:Cluh UTSW 11 74665986 missense probably benign 0.05
R0834:Cluh UTSW 11 74663805 missense probably benign 0.02
R1991:Cluh UTSW 11 74659529 nonsense probably null
R1992:Cluh UTSW 11 74660002 missense probably damaging 1.00
R2095:Cluh UTSW 11 74661724 nonsense probably null
R2101:Cluh UTSW 11 74660502 splice site probably benign
R2103:Cluh UTSW 11 74659529 nonsense probably null
R2220:Cluh UTSW 11 74667121 missense probably damaging 1.00
R3702:Cluh UTSW 11 74665356 missense probably benign
R3853:Cluh UTSW 11 74656453 missense probably benign 0.00
R3900:Cluh UTSW 11 74667104 missense probably benign 0.29
R4891:Cluh UTSW 11 74665059 missense possibly damaging 0.51
R4895:Cluh UTSW 11 74667405 missense probably damaging 1.00
R5056:Cluh UTSW 11 74661946 missense probably damaging 1.00
R5089:Cluh UTSW 11 74660372 missense probably damaging 1.00
R5217:Cluh UTSW 11 74659705 missense probably damaging 1.00
R5346:Cluh UTSW 11 74665218 missense probably damaging 1.00
R5382:Cluh UTSW 11 74665109 intron probably benign
R5516:Cluh UTSW 11 74660444 missense probably damaging 1.00
R5809:Cluh UTSW 11 74661700 missense probably damaging 1.00
R6146:Cluh UTSW 11 74667228 splice site probably null
R6326:Cluh UTSW 11 74666242 missense probably benign 0.10
R6541:Cluh UTSW 11 74657214 missense probably damaging 1.00
R6674:Cluh UTSW 11 74666227 missense probably damaging 1.00
R6870:Cluh UTSW 11 74665384 missense probably damaging 1.00
R6875:Cluh UTSW 11 74661918 missense probably damaging 1.00
X0028:Cluh UTSW 11 74663466 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GTACTCAATGACCGAGACGAGG -3'
(R):5'- GTTCCTGCATCTGGAGATCTG -3'

Sequencing Primer
(F):5'- CTGCTCCTCGGTCGAGTGTAAG -3'
(R):5'- CATCTGGAGATCTGAGGCAGGC -3'
Posted On2014-06-30