Incidental Mutation 'R1873:Mark2'
ID210988
Institutional Source Beutler Lab
Gene Symbol Mark2
Ensembl Gene ENSMUSG00000024969
Gene NameMAP/microtubule affinity regulating kinase 2
SynonymsEmk, Par-1
MMRRC Submission 039895-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R1873 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location7275396-7341860 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 7284515 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 351 (Y351H)
Ref Sequence ENSEMBL: ENSMUSP00000128560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025921] [ENSMUST00000032557] [ENSMUST00000051711] [ENSMUST00000164129] [ENSMUST00000164205] [ENSMUST00000165286] [ENSMUST00000165965] [ENSMUST00000166461] [ENSMUST00000167767] [ENSMUST00000168872] [ENSMUST00000169541] [ENSMUST00000171352] [ENSMUST00000171393]
Predicted Effect probably damaging
Transcript: ENSMUST00000025921
AA Change: Y318H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025921
Gene: ENSMUSG00000024969
AA Change: Y318H

DomainStartEndE-ValueType
S_TKc 20 271 1.59e-108 SMART
UBA 292 329 7.69e-7 SMART
low complexity region 475 489 N/A INTRINSIC
low complexity region 532 545 N/A INTRINSIC
Pfam:KA1 697 743 2.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000032557
AA Change: Y351H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032557
Gene: ENSMUSG00000024969
AA Change: Y351H

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 685 731 5.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000051711
AA Change: Y351H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108969
Gene: ENSMUSG00000024969
AA Change: Y351H

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 730 776 6.6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163345
SMART Domains Protein: ENSMUSP00000125944
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
low complexity region 58 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164129
Predicted Effect probably damaging
Transcript: ENSMUST00000164205
AA Change: Y351H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127827
Gene: ENSMUSG00000024969
AA Change: Y351H

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 676 722 5.4e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165286
AA Change: Y351H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126468
Gene: ENSMUSG00000024969
AA Change: Y351H

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 670 716 6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165881
SMART Domains Protein: ENSMUSP00000126753
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 88 102 N/A INTRINSIC
low complexity region 145 158 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165965
AA Change: Y351H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131684
Gene: ENSMUSG00000024969
AA Change: Y351H

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 508 522 N/A INTRINSIC
low complexity region 565 578 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166461
SMART Domains Protein: ENSMUSP00000128549
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 45 59 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
Pfam:KA1 261 307 1.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167767
SMART Domains Protein: ENSMUSP00000132482
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 53 66 N/A INTRINSIC
PDB:3OSE|A 220 264 1e-18 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168852
Predicted Effect probably damaging
Transcript: ENSMUST00000168872
AA Change: Y351H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128560
Gene: ENSMUSG00000024969
AA Change: Y351H

DomainStartEndE-ValueType
S_TKc 53 304 1.59e-108 SMART
UBA 325 362 7.69e-7 SMART
low complexity region 511 524 N/A INTRINSIC
Pfam:KA1 661 707 5.9e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169541
SMART Domains Protein: ENSMUSP00000128779
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 53 110 1.7e-12 PFAM
Pfam:Pkinase_Tyr 53 110 7.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170768
Predicted Effect probably benign
Transcript: ENSMUST00000171352
SMART Domains Protein: ENSMUSP00000129490
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171393
SMART Domains Protein: ENSMUSP00000129894
Gene: ENSMUSG00000024969

DomainStartEndE-ValueType
Pfam:Pkinase 20 193 1.2e-59 PFAM
Pfam:Pkinase_Tyr 20 193 1.2e-35 PFAM
Pfam:RIO1 30 174 3e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000171721
AA Change: Y341H
SMART Domains Protein: ENSMUSP00000129506
Gene: ENSMUSG00000024969
AA Change: Y341H

DomainStartEndE-ValueType
S_TKc 44 295 1.59e-108 SMART
UBA 316 353 7.69e-7 SMART
low complexity region 499 513 N/A INTRINSIC
low complexity region 556 569 N/A INTRINSIC
Pfam:KA1 732 776 7.2e-24 PFAM
Meta Mutation Damage Score 0.368 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 98% (82/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Par-1 family of serine/threonine protein kinases. The protein is an important regulator of cell polarity in epithelial and neuronal cells, and also controls the stability of microtubules through phosphorylation and inactivation of several microtubule-associating proteins. The protein localizes to cell membranes. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit proportionate dwarfism with smaller pituitaries and reduced growth hormone and prolactin secretion. Mutants develop autoimmunity and fail to breed when mated to each other. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,979,955 I124L probably benign Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam34 A C 8: 43,651,806 N267K probably benign Het
Anxa5 T C 3: 36,449,402 D301G probably damaging Het
Atf7ip G T 6: 136,559,888 D40Y probably damaging Het
Cacna2d2 T G 9: 107,513,872 M400R probably damaging Het
Cd96 C A 16: 46,117,972 L43F probably damaging Het
Cep120 T C 18: 53,738,488 E104G probably damaging Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Chil4 C T 3: 106,206,098 E168K probably benign Het
Clca3a1 A G 3: 144,746,829 V631A probably damaging Het
Cluh C T 11: 74,662,076 A649V possibly damaging Het
Commd9 A G 2: 101,897,157 T99A probably benign Het
Csgalnact1 T C 8: 68,401,384 N255S probably benign Het
Cyth3 T A 5: 143,697,761 H138Q possibly damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fyco1 A G 9: 123,823,238 V1135A probably benign Het
Glcci1 C A 6: 8,537,837 H152N probably benign Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm4788 C T 1: 139,774,660 E29K probably damaging Het
Gnrhr A G 5: 86,182,201 L320P probably damaging Het
Gorasp1 A T 9: 119,930,240 S138T probably benign Het
Hars C A 18: 36,767,241 Q469H probably damaging Het
Homer2 T C 7: 81,636,363 K34E probably damaging Het
Hscb T C 5: 110,830,957 I198V probably benign Het
Kat6b T C 14: 21,516,989 S39P probably damaging Het
Kcnk12 G T 17: 87,746,071 Q388K probably damaging Het
Kcnq3 A G 15: 66,002,255 I548T probably benign Het
Masp2 A T 4: 148,614,495 I678F probably damaging Het
Mc4r A T 18: 66,859,460 I194N probably damaging Het
Ms4a6d A G 19: 11,601,859 S85P probably damaging Het
Mum1 T A 10: 80,232,608 D195E possibly damaging Het
Myh4 T A 11: 67,254,743 Y1351N probably benign Het
Myo16 A G 8: 10,272,789 D73G probably damaging Het
Mzt1 C T 14: 99,040,661 probably null Het
Nalcn G A 14: 123,283,601 H1631Y probably benign Het
Ncf2 A G 1: 152,825,910 N213S probably benign Het
Nf1 C A 11: 79,547,161 T99K probably damaging Het
Nsf T C 11: 103,859,017 S547G probably damaging Het
Ntrk3 T A 7: 78,462,839 I190F probably benign Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Ogdh A T 11: 6,340,438 probably benign Het
Olfr1448 C T 19: 12,919,488 V274M probably damaging Het
Olfr693 T A 7: 106,678,484 M1L probably damaging Het
Otog G A 7: 46,269,343 V948I probably damaging Het
Plekhm1 T C 11: 103,373,998 D880G probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Polg A G 7: 79,456,493 L678S probably benign Het
Ptprm C T 17: 66,688,355 V1293I probably damaging Het
Rhou A T 8: 123,661,251 R241W probably damaging Het
Rtn4 A T 11: 29,736,437 N264I probably damaging Het
Sez6l T C 5: 112,473,410 probably benign Het
Sost T C 11: 101,964,243 E80G probably damaging Het
Spag16 C T 1: 69,896,585 probably benign Het
Speer4f2 A T 5: 17,374,449 N82I probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Taf1b T A 12: 24,556,669 L496Q possibly damaging Het
Tarbp1 A G 8: 126,447,047 I976T probably damaging Het
Tex14 T A 11: 87,499,605 V376D probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tm9sf1 T C 14: 55,636,223 D606G probably damaging Het
Tmc2 A C 2: 130,248,756 N674T possibly damaging Het
Top3a C A 11: 60,747,984 E562* probably null Het
Umodl1 A T 17: 30,982,264 D389V probably damaging Het
Uso1 T C 5: 92,192,859 probably benign Het
Vmn1r205 A G 13: 22,592,053 V293A possibly damaging Het
Vmn2r107 A G 17: 20,345,578 T52A probably benign Het
Vmn2r4 C T 3: 64,391,058 V461I possibly damaging Het
Vmn2r99 A T 17: 19,362,153 I7F probably benign Het
Vps11 A G 9: 44,359,936 F80S probably damaging Het
Wdr43 A G 17: 71,633,652 S258G probably benign Het
Zbtb24 A G 10: 41,451,127 D3G probably benign Het
Zc3hav1 C T 6: 38,332,757 V377I possibly damaging Het
Zfp668 T C 7: 127,866,482 probably null Het
Other mutations in Mark2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Mark2 APN 19 7341184 missense possibly damaging 0.53
IGL01522:Mark2 APN 19 7281238 missense probably benign 0.06
IGL02368:Mark2 APN 19 7284490 missense probably damaging 1.00
IGL02836:Mark2 APN 19 7278040 critical splice donor site probably null
IGL03233:Mark2 APN 19 7284726 missense possibly damaging 0.89
R0015:Mark2 UTSW 19 7285777 nonsense probably null
R0025:Mark2 UTSW 19 7285922 missense probably damaging 1.00
R0025:Mark2 UTSW 19 7285922 missense probably damaging 1.00
R0035:Mark2 UTSW 19 7284652 splice site probably benign
R0035:Mark2 UTSW 19 7284652 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0047:Mark2 UTSW 19 7283577 splice site probably benign
R0335:Mark2 UTSW 19 7281828 missense probably benign 0.27
R0627:Mark2 UTSW 19 7281960 critical splice acceptor site probably null
R0734:Mark2 UTSW 19 7285981 splice site probably benign
R0744:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R0836:Mark2 UTSW 19 7285824 missense probably damaging 1.00
R1099:Mark2 UTSW 19 7277425 missense probably benign 0.41
R1861:Mark2 UTSW 19 7290763 missense possibly damaging 0.73
R2160:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2161:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2162:Mark2 UTSW 19 7282747 missense probably damaging 1.00
R2308:Mark2 UTSW 19 7281934 missense probably damaging 1.00
R2844:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2845:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2846:Mark2 UTSW 19 7286862 missense probably damaging 1.00
R2902:Mark2 UTSW 19 7283448 missense probably benign 0.00
R2935:Mark2 UTSW 19 7285889 missense probably benign 0.09
R3853:Mark2 UTSW 19 7277290 missense probably damaging 1.00
R4377:Mark2 UTSW 19 7290689 missense possibly damaging 0.66
R4522:Mark2 UTSW 19 7285948 missense probably damaging 1.00
R4737:Mark2 UTSW 19 7281232 missense probably damaging 0.96
R5103:Mark2 UTSW 19 7284503 missense probably damaging 1.00
R5154:Mark2 UTSW 19 7283074 missense probably damaging 0.99
R5579:Mark2 UTSW 19 7282816 missense probably damaging 1.00
R6163:Mark2 UTSW 19 7290761 missense probably benign 0.00
R6186:Mark2 UTSW 19 7283202 missense probably benign 0.01
R6387:Mark2 UTSW 19 7285902 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCCACTGAGGGCCTTATC -3'
(R):5'- ATGTGGAACCTCTCCCTGAC -3'

Sequencing Primer
(F):5'- GCTGAGGCCTCACGTTAAATTAAGC -3'
(R):5'- GTGGAACCTCTCCCTGACTACAAG -3'
Posted On2014-06-30