Incidental Mutation 'R1874:Slx4'
ID211092
Institutional Source Beutler Lab
Gene Symbol Slx4
Ensembl Gene ENSMUSG00000039738
Gene NameSLX4 structure-specific endonuclease subunit homolog (S. cerevisiae)
SynonymsBtbd12, D16Bwg1016e
MMRRC Submission 039896-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1874 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location3979105-4003770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3986848 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 701 (S701P)
Ref Sequence ENSEMBL: ENSMUSP00000038871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040790]
Predicted Effect probably benign
Transcript: ENSMUST00000040790
AA Change: S701P

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000038871
Gene: ENSMUSG00000039738
AA Change: S701P

DomainStartEndE-ValueType
low complexity region 400 413 N/A INTRINSIC
BTB 506 609 6.15e-7 SMART
low complexity region 651 667 N/A INTRINSIC
low complexity region 833 849 N/A INTRINSIC
low complexity region 857 875 N/A INTRINSIC
low complexity region 1176 1192 N/A INTRINSIC
low complexity region 1437 1461 N/A INTRINSIC
Pfam:Slx4 1484 1541 3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128980
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145706
Predicted Effect probably benign
Transcript: ENSMUST00000146569
SMART Domains Protein: ENSMUSP00000126423
Gene: ENSMUSG00000039738

DomainStartEndE-ValueType
Pfam:BTB 6 102 6.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156542
Meta Mutation Damage Score 0 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 94.1%
Validation Efficiency 96% (105/109)
MGI Phenotype FUNCTION: This gene encodes a protein containing a BTB (POZ) domain that comprises a subunit of structure-specific endonucleases. The encoded protein aids in the resolution of DNA secondary structures that arise during the processes of DNA repair and recombination. Knock out of this gene in mouse recapitulates the phenotype of the human disease Fanconi anemia, including blood cytopenia and susceptibility to genomic instability. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit some preweaning lethality, reduced fertility, abnormal eye morphology, abnormal skeletal morphology, hydrocephalus, chromosomal instability, early cellular replicative senescence, and abnormal lymphopoeisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 A G 1: 130,742,691 S217G probably benign Het
Adrb3 C A 8: 27,227,563 R286L probably damaging Het
Akap11 T A 14: 78,511,866 D1027V probably benign Het
Ank3 A T 10: 69,898,083 I726F probably damaging Het
Ankmy2 T A 12: 36,165,931 D43E possibly damaging Het
Ankrd34b A G 13: 92,439,556 D432G probably damaging Het
Ano3 A C 2: 110,884,872 S74A probably benign Het
B4galnt4 T A 7: 141,070,526 S769T probably damaging Het
Bicral T A 17: 46,825,178 T369S probably benign Het
Blm A G 7: 80,497,418 L738P probably damaging Het
Bpifb3 A G 2: 153,925,840 T278A probably benign Het
Bpifb5 A G 2: 154,227,202 probably benign Het
Brd8 G C 18: 34,610,474 P266R probably damaging Het
Btaf1 A T 19: 36,980,583 M587L probably benign Het
Casz1 C G 4: 148,943,211 T1015S probably damaging Het
Cdh23 A G 10: 60,436,818 I524T possibly damaging Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cenpf A G 1: 189,683,816 L104P probably damaging Het
Clasp1 G T 1: 118,600,585 probably null Het
Coprs A G 8: 13,885,112 W148R probably damaging Het
Cpne1 A G 2: 156,078,382 S168P probably damaging Het
Cpxm2 T C 7: 132,059,834 Y408C probably damaging Het
Ctnna3 A G 10: 63,504,107 E24G possibly damaging Het
Cubn T A 2: 13,323,002 S2671C probably damaging Het
Cyp4f39 T A 17: 32,483,324 F265Y probably damaging Het
Dgkq C A 5: 108,660,595 R34L probably benign Het
Dnajc7 C T 11: 100,599,313 probably benign Het
Eml6 T G 11: 29,831,136 D632A probably damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fbxw22 A T 9: 109,385,111 C212* probably null Het
Ffar2 A G 7: 30,819,414 probably null Het
Fga A T 3: 83,032,721 T561S probably damaging Het
Fry A G 5: 150,345,921 Y159C probably damaging Het
Gal3st1 A G 11: 3,998,231 Y146C probably damaging Het
Gapvd1 A T 2: 34,706,021 H788Q probably damaging Het
Gimap7 G A 6: 48,723,515 V12I possibly damaging Het
Gli2 C A 1: 119,002,049 A43S possibly damaging Het
Gm15446 T C 5: 109,942,553 F224L probably damaging Het
Gm21738 C T 14: 19,418,824 V35I possibly damaging Het
Grhl1 T C 12: 24,586,156 probably benign Het
Grk6 T C 13: 55,450,273 Y53H probably damaging Het
Hcar1 C T 5: 123,879,265 R121K probably damaging Het
Hmcn1 A C 1: 150,720,695 S1797A probably damaging Het
Hsd17b7 A T 1: 169,955,993 L282Q possibly damaging Het
Irs1 TTCTCTGAGTGGCCACAGCGTCT TTCT 1: 82,289,853 probably null Het
Kif1b C T 4: 149,187,632 V1571I probably benign Het
Lpl T A 8: 68,896,619 C266S probably damaging Het
Mag G A 7: 30,909,051 H213Y probably benign Het
Mansc4 T G 6: 147,075,190 R309S probably benign Het
Mlh3 A G 12: 85,237,513 probably null Het
Mndal G A 1: 173,860,367 probably benign Het
Mrgpra2b T A 7: 47,463,994 E330V probably damaging Het
Myh3 A G 11: 67,093,179 I990V probably benign Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Naa16 T C 14: 79,355,743 E463G possibly damaging Het
Nadsyn1 A G 7: 143,797,844 F684S probably damaging Het
Notch1 T C 2: 26,481,579 E286G possibly damaging Het
Nynrin A T 14: 55,863,493 I247L probably benign Het
Olfr136 C T 17: 38,335,969 P271S probably damaging Het
Olfr644 T C 7: 104,068,129 I301V probably null Het
Olfr981 T A 9: 40,022,855 I154N possibly damaging Het
Oprm1 A G 10: 6,789,035 H54R probably benign Het
P4hb C T 11: 120,562,166 D483N probably benign Het
Pak1 T C 7: 97,871,580 S149P probably benign Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pih1d2 A G 9: 50,620,945 M88V possibly damaging Het
Pms1 A T 1: 53,207,233 N382K probably benign Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Pole G A 5: 110,323,664 V1425M possibly damaging Het
Pot1b T A 17: 55,654,805 Q591L probably benign Het
Ppp1r9a C T 6: 4,906,348 T301M possibly damaging Het
Psg21 T C 7: 18,650,816 E335G probably benign Het
Ptpru T A 4: 131,769,755 M1416L probably benign Het
Pxn T C 5: 115,544,990 V117A probably damaging Het
Qsox1 C T 1: 155,812,639 R54H possibly damaging Het
Rad1 A G 15: 10,488,006 E42G probably damaging Het
Rpp14 A G 14: 8,090,145 Y23C probably benign Het
Sdk2 C T 11: 113,834,956 V1156I probably benign Het
Serpina3j G T 12: 104,319,699 R371L probably benign Het
Serpinb9d T A 13: 33,197,963 probably null Het
Sirt5 C T 13: 43,370,791 S13F possibly damaging Het
Slc6a7 T A 18: 61,001,398 probably benign Het
Snx29 A G 16: 11,367,681 T43A probably benign Het
Speg T C 1: 75,423,906 V2570A probably benign Het
Srrm4 T A 5: 116,453,506 probably benign Het
Stk32a A G 18: 43,261,316 Y110C probably damaging Het
Tbc1d31 G A 15: 57,916,110 G73E probably benign Het
Thsd7a A T 6: 12,555,435 I150N possibly damaging Het
Tjp1 A T 7: 65,319,253 D699E probably damaging Het
Tmem143 A G 7: 45,916,564 D437G possibly damaging Het
Tmem45a2 A G 16: 57,047,084 Y85H possibly damaging Het
Tmem45b T A 9: 31,429,087 T7S probably damaging Het
Ube4b A G 4: 149,347,971 L832P probably damaging Het
Ugp2 G T 11: 21,329,048 F379L probably damaging Het
Ugt3a2 A T 15: 9,365,351 D350V probably damaging Het
Vmn2r8 T A 5: 108,802,418 T188S possibly damaging Het
Vwa7 C G 17: 35,017,112 P14R probably benign Het
Vwc2 C A 11: 11,261,495 T317K probably damaging Het
Vwf A T 6: 125,628,372 Q906L probably benign Het
Wdr49 A G 3: 75,429,347 V351A probably damaging Het
Wdr7 A G 18: 63,728,504 S196G probably benign Het
Xkr6 C A 14: 63,798,296 A26E unknown Het
Zcchc11 T A 4: 108,550,725 V1397D probably damaging Het
Zfp955b T C 17: 33,305,453 I47V probably benign Het
Other mutations in Slx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Slx4 APN 16 3990888 missense probably benign 0.17
IGL01767:Slx4 APN 16 3990248 missense probably benign 0.01
IGL02525:Slx4 APN 16 3980597 missense probably damaging 1.00
slim UTSW 16 3990910 nonsense probably null
R0033:Slx4 UTSW 16 3988000 missense probably benign 0.08
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0070:Slx4 UTSW 16 3988016 missense possibly damaging 0.71
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0242:Slx4 UTSW 16 3986952 missense probably damaging 0.99
R0363:Slx4 UTSW 16 3980089 missense probably damaging 1.00
R0433:Slx4 UTSW 16 3986018 missense probably benign 0.01
R0993:Slx4 UTSW 16 3985825 missense probably benign 0.00
R1083:Slx4 UTSW 16 3990910 nonsense probably null
R1373:Slx4 UTSW 16 3985510 missense probably benign 0.02
R1710:Slx4 UTSW 16 3999158 missense probably benign 0.15
R1712:Slx4 UTSW 16 3991594 missense probably damaging 0.99
R1937:Slx4 UTSW 16 3987166 makesense probably null
R2008:Slx4 UTSW 16 3979921 missense probably damaging 1.00
R2156:Slx4 UTSW 16 3986359 missense probably benign 0.00
R2427:Slx4 UTSW 16 3988987 missense probably damaging 0.99
R3765:Slx4 UTSW 16 3980986 missense probably damaging 1.00
R3890:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R3891:Slx4 UTSW 16 3979909 missense probably damaging 1.00
R4465:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4467:Slx4 UTSW 16 3989055 missense possibly damaging 0.82
R4497:Slx4 UTSW 16 3994909 missense probably damaging 1.00
R4882:Slx4 UTSW 16 3980996 critical splice acceptor site probably null
R5119:Slx4 UTSW 16 4001199 missense possibly damaging 0.89
R5384:Slx4 UTSW 16 3990805 missense probably damaging 1.00
R5472:Slx4 UTSW 16 3991540 missense probably benign 0.13
R5578:Slx4 UTSW 16 3986862 missense probably damaging 1.00
R5582:Slx4 UTSW 16 3985788 missense possibly damaging 0.93
R5696:Slx4 UTSW 16 3979967 missense probably damaging 1.00
R5827:Slx4 UTSW 16 4001284 missense possibly damaging 0.94
R5964:Slx4 UTSW 16 4000951 critical splice donor site probably null
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6032:Slx4 UTSW 16 3980157 missense probably damaging 1.00
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6039:Slx4 UTSW 16 3986047 missense possibly damaging 0.82
R6345:Slx4 UTSW 16 3990850 missense probably benign 0.06
R6612:Slx4 UTSW 16 3985276 missense probably damaging 0.99
R6979:Slx4 UTSW 16 3985015 missense probably damaging 0.96
R6989:Slx4 UTSW 16 3995838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCAAGCACTCTTTCCCC -3'
(R):5'- GAGACTCTGCTGAAACCTGAG -3'

Sequencing Primer
(F):5'- CAGAAGCTGGGGTCGTCAG -3'
(R):5'- TGCTGAAACCTGAGCTCTG -3'
Posted On2014-06-30