Incidental Mutation 'R1875:Shroom1'
ID211164
Institutional Source Beutler Lab
Gene Symbol Shroom1
Ensembl Gene ENSMUSG00000018387
Gene Nameshroom family member 1
SynonymsShrm1, Apx, 1300007L22Rik
MMRRC Submission 039897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R1875 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location53457205-53467766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53465675 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 392 (D392G)
Ref Sequence ENSEMBL: ENSMUSP00000018531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018531] [ENSMUST00000057722] [ENSMUST00000093114] [ENSMUST00000109013]
Predicted Effect probably damaging
Transcript: ENSMUST00000018531
AA Change: D392G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000018531
Gene: ENSMUSG00000018387
AA Change: D392G

DomainStartEndE-ValueType
Pfam:ASD1 108 269 1.1e-21 PFAM
low complexity region 410 417 N/A INTRINSIC
Pfam:ASD2 454 732 4.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057722
Predicted Effect probably damaging
Transcript: ENSMUST00000093114
AA Change: D455G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090802
Gene: ENSMUSG00000018387
AA Change: D455G

DomainStartEndE-ValueType
Pfam:ASD1 108 269 3.7e-22 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 517 715 1e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109010
Predicted Effect probably damaging
Transcript: ENSMUST00000109013
AA Change: D455G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104641
Gene: ENSMUSG00000018387
AA Change: D455G

DomainStartEndE-ValueType
Pfam:ASD1 114 269 4.2e-19 PFAM
low complexity region 473 480 N/A INTRINSIC
Pfam:ASD2 518 795 2.4e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155297
Meta Mutation Damage Score 0.0236 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHROOM family members play diverse roles in the development of the nervous system and other tissues (Hagens et al., 2006 [PubMed 16615870]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,358 D772G probably damaging Het
Abca14 A T 7: 120,247,967 M685L possibly damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam26a C A 8: 43,569,851 V201L probably benign Het
Adamts20 G T 15: 94,331,396 D947E probably benign Het
Ankrd26 A G 6: 118,540,449 probably null Het
Apol11a C A 15: 77,513,566 T39N possibly damaging Het
Arhgef38 T A 3: 133,133,740 probably null Het
Atp11b T C 3: 35,839,147 L883P probably damaging Het
Btnl10 T A 11: 58,923,760 I422N probably damaging Het
C2cd3 A G 7: 100,407,025 K547E possibly damaging Het
Cdh2 T A 18: 16,624,877 L549F probably benign Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Csmd1 T C 8: 15,929,101 K2828E probably damaging Het
Ddah2 T C 17: 35,060,845 F137S probably damaging Het
Ddx21 A G 10: 62,594,068 I299T probably damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Elmod1 A G 9: 53,935,867 I9T probably benign Het
Epha2 A G 4: 141,308,979 E242G probably benign Het
Erbb3 T C 10: 128,574,466 H641R possibly damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fli1 T C 9: 32,423,913 M408V probably benign Het
Fmo4 T C 1: 162,803,618 N260S possibly damaging Het
Fry A G 5: 150,326,132 E136G probably damaging Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm8258 A G 5: 104,776,454 noncoding transcript Het
Gpr68 T A 12: 100,878,790 D165V probably damaging Het
Htt T A 5: 34,794,112 M139K probably benign Het
Jup A G 11: 100,372,294 probably null Het
Kifc5b G A 17: 26,917,290 probably null Het
Krba1 T A 6: 48,414,049 probably null Het
Lamp1 G A 8: 13,167,257 G89R probably damaging Het
Lexm G A 4: 106,613,256 probably benign Het
Lrrc17 C T 5: 21,560,652 S44F possibly damaging Het
Mdga1 T C 17: 29,852,607 T347A probably damaging Het
Mical3 A T 6: 121,042,064 W66R probably damaging Het
Mpl A G 4: 118,456,829 Y73H probably benign Het
Mterf1b T A 5: 4,197,364 I335N possibly damaging Het
Mylk3 A G 8: 85,352,865 I388T probably damaging Het
Myo15 C T 11: 60,507,528 R2775W probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Ndrg1 T C 15: 66,931,091 T137A possibly damaging Het
Neil3 G T 8: 53,599,419 N381K probably damaging Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Olfr124 A G 17: 37,805,105 probably benign Het
Olfr711 G A 7: 106,972,182 S54F possibly damaging Het
Otogl T C 10: 107,899,590 D111G probably damaging Het
Parp10 T C 15: 76,242,851 E103G probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pcdh18 A T 3: 49,754,705 F720L probably damaging Het
Phf3 T C 1: 30,830,623 E448G possibly damaging Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Pik3c2a A T 7: 116,417,971 S184T probably benign Het
Pkd1l1 A G 11: 8,844,670 probably benign Het
Plch2 G A 4: 154,998,508 S485F probably damaging Het
Plxnd1 G T 6: 115,978,084 probably null Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Prl8a2 T C 13: 27,351,054 V103A probably benign Het
Psg23 G A 7: 18,610,450 T360I probably benign Het
Rad51c A T 11: 87,388,643 I323N probably damaging Het
Rsbn1l C T 5: 20,951,698 E30K probably benign Het
Serpina3c C A 12: 104,151,886 L64F probably damaging Het
Slc26a5 T A 5: 21,815,727 I540L probably benign Het
Slc37a4 A G 9: 44,401,511 T321A probably damaging Het
Slc41a2 A G 10: 83,256,085 L438S probably damaging Het
Spef2 C T 15: 9,584,108 E1624K probably damaging Het
Spef2 C T 15: 9,597,401 G1390R possibly damaging Het
Synj2 G T 17: 6,028,550 A740S possibly damaging Het
Thegl A T 5: 77,054,584 K284M probably benign Het
Tigd4 A C 3: 84,595,087 D437A probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem106a CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA 11: 101,586,378 probably benign Het
Tmem131l A T 3: 83,905,076 C1313* probably null Het
Tmem86b A T 7: 4,629,699 I47N possibly damaging Het
Tspan13 T C 12: 36,020,551 probably null Het
Vps54 A G 11: 21,300,251 T396A probably benign Het
Zfp106 A T 2: 120,513,615 probably null Het
Zfp668 T C 7: 127,866,482 probably null Het
Zfp809 A T 9: 22,238,731 R175* probably null Het
Other mutations in Shroom1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Shroom1 APN 11 53464094 missense probably benign 0.00
IGL00985:Shroom1 APN 11 53465969 missense probably benign
IGL01111:Shroom1 APN 11 53464048 missense probably damaging 0.98
IGL01316:Shroom1 APN 11 53465558 missense probably damaging 0.99
IGL02512:Shroom1 APN 11 53466559 missense probably damaging 1.00
IGL03062:Shroom1 APN 11 53463379 missense probably benign
R0083:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0108:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R0242:Shroom1 UTSW 11 53465485 splice site probably null
R0242:Shroom1 UTSW 11 53465485 splice site probably null
R0357:Shroom1 UTSW 11 53465208 missense probably damaging 0.96
R0661:Shroom1 UTSW 11 53466937 missense possibly damaging 0.93
R2356:Shroom1 UTSW 11 53466447 missense probably benign 0.05
R4657:Shroom1 UTSW 11 53465588 missense possibly damaging 0.79
R4662:Shroom1 UTSW 11 53466462 missense possibly damaging 0.64
R4690:Shroom1 UTSW 11 53465722 missense possibly damaging 0.91
R4734:Shroom1 UTSW 11 53465233 missense probably damaging 1.00
R4820:Shroom1 UTSW 11 53465139 missense probably benign 0.07
R4964:Shroom1 UTSW 11 53465172 missense probably benign
R5000:Shroom1 UTSW 11 53467117 utr 3 prime probably benign
R5046:Shroom1 UTSW 11 53464045 missense probably benign 0.00
R5141:Shroom1 UTSW 11 53463982 nonsense probably null
R5256:Shroom1 UTSW 11 53465507 missense probably benign 0.32
R5273:Shroom1 UTSW 11 53463844 missense possibly damaging 0.82
R5529:Shroom1 UTSW 11 53463922 missense probably damaging 1.00
R5762:Shroom1 UTSW 11 53463991 missense probably benign 0.00
R6058:Shroom1 UTSW 11 53463481 missense possibly damaging 0.83
R6408:Shroom1 UTSW 11 53463387 missense probably benign 0.00
R6677:Shroom1 UTSW 11 53463516 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTCCTACCGGCAGTATGAAAACG -3'
(R):5'- AAAGAGGGATCCAGTCTGGC -3'

Sequencing Primer
(F):5'- CCGGCAGTATGAAAACGACTTAAGC -3'
(R):5'- AGTCTGGCCAGCTCTTGAAC -3'
Posted On2014-06-30