Incidental Mutation 'R1875:Spef2'
ID211177
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
MMRRC Submission 039897-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1875 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9597401 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1390 (G1390R)
Ref Sequence ENSEMBL: ENSMUSP00000124222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160236] [ENSMUST00000208854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159288
AA Change: G1400R

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663
AA Change: G1400R

DomainStartEndE-ValueType
Pfam:CH_2 5 102 3.1e-25 PFAM
low complexity region 106 115 N/A INTRINSIC
low complexity region 137 148 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 602 789 8.8e-11 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1221 N/A INTRINSIC
low complexity region 1264 1278 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
SCOP:d1rec__ 1378 1530 3e-3 SMART
low complexity region 1605 1624 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160236
AA Change: G1390R

PolyPhen 2 Score 0.782 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: G1390R

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208854
Meta Mutation Damage Score 0.226 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.1%
Validation Efficiency 98% (85/87)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,682,358 D772G probably damaging Het
Abca14 A T 7: 120,247,967 M685L possibly damaging Het
Abi3bp A G 16: 56,574,499 Y190C probably damaging Het
Adam26a C A 8: 43,569,851 V201L probably benign Het
Adamts20 G T 15: 94,331,396 D947E probably benign Het
Ankrd26 A G 6: 118,540,449 probably null Het
Apol11a C A 15: 77,513,566 T39N possibly damaging Het
Arhgef38 T A 3: 133,133,740 probably null Het
Atp11b T C 3: 35,839,147 L883P probably damaging Het
Btnl10 T A 11: 58,923,760 I422N probably damaging Het
C2cd3 A G 7: 100,407,025 K547E possibly damaging Het
Cdh2 T A 18: 16,624,877 L549F probably benign Het
Celsr3 T C 9: 108,835,838 V1825A probably benign Het
Cfap221 T C 1: 119,953,659 I358V probably benign Het
Csmd1 T C 8: 15,929,101 K2828E probably damaging Het
Ddah2 T C 17: 35,060,845 F137S probably damaging Het
Ddx21 A G 10: 62,594,068 I299T probably damaging Het
Dnah7a A T 1: 53,456,532 probably benign Het
Elmod1 A G 9: 53,935,867 I9T probably benign Het
Epha2 A G 4: 141,308,979 E242G probably benign Het
Erbb3 T C 10: 128,574,466 H641R possibly damaging Het
Fbxl18 G A 5: 142,886,223 A419V probably damaging Het
Fli1 T C 9: 32,423,913 M408V probably benign Het
Fmo4 T C 1: 162,803,618 N260S possibly damaging Het
Fry A G 5: 150,326,132 E136G probably damaging Het
Gm10477 T A X: 56,524,767 F9Y probably damaging Het
Gm8258 A G 5: 104,776,454 noncoding transcript Het
Gpr68 T A 12: 100,878,790 D165V probably damaging Het
Htt T A 5: 34,794,112 M139K probably benign Het
Jup A G 11: 100,372,294 probably null Het
Kifc5b G A 17: 26,917,290 probably null Het
Krba1 T A 6: 48,414,049 probably null Het
Lamp1 G A 8: 13,167,257 G89R probably damaging Het
Lexm G A 4: 106,613,256 probably benign Het
Lrrc17 C T 5: 21,560,652 S44F possibly damaging Het
Mdga1 T C 17: 29,852,607 T347A probably damaging Het
Mical3 A T 6: 121,042,064 W66R probably damaging Het
Mpl A G 4: 118,456,829 Y73H probably benign Het
Mterf1b T A 5: 4,197,364 I335N possibly damaging Het
Mylk3 A G 8: 85,352,865 I388T probably damaging Het
Myo15 C T 11: 60,507,528 R2775W probably damaging Het
Myoz2 A T 3: 123,026,116 S65T probably damaging Het
Ndrg1 T C 15: 66,931,091 T137A possibly damaging Het
Neil3 G T 8: 53,599,419 N381K probably damaging Het
Obsl1 T C 1: 75,498,233 Y841C probably damaging Het
Olfr124 A G 17: 37,805,105 probably benign Het
Olfr711 G A 7: 106,972,182 S54F possibly damaging Het
Otogl T C 10: 107,899,590 D111G probably damaging Het
Parp10 T C 15: 76,242,851 E103G probably damaging Het
Pars2 T C 4: 106,653,716 F232L possibly damaging Het
Pcdh18 A T 3: 49,754,705 F720L probably damaging Het
Phf3 T C 1: 30,830,623 E448G possibly damaging Het
Pigc A G 1: 161,970,947 Y166C probably damaging Het
Pik3c2a A T 7: 116,417,971 S184T probably benign Het
Pkd1l1 A G 11: 8,844,670 probably benign Het
Plch2 G A 4: 154,998,508 S485F probably damaging Het
Plxnd1 G T 6: 115,978,084 probably null Het
Pnliprp2 G T 19: 58,763,389 V189L probably benign Het
Prl8a2 T C 13: 27,351,054 V103A probably benign Het
Psg23 G A 7: 18,610,450 T360I probably benign Het
Rad51c A T 11: 87,388,643 I323N probably damaging Het
Rsbn1l C T 5: 20,951,698 E30K probably benign Het
Serpina3c C A 12: 104,151,886 L64F probably damaging Het
Shroom1 A G 11: 53,465,675 D392G probably damaging Het
Slc26a5 T A 5: 21,815,727 I540L probably benign Het
Slc37a4 A G 9: 44,401,511 T321A probably damaging Het
Slc41a2 A G 10: 83,256,085 L438S probably damaging Het
Synj2 G T 17: 6,028,550 A740S possibly damaging Het
Thegl A T 5: 77,054,584 K284M probably benign Het
Tigd4 A C 3: 84,595,087 D437A probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem106a CAGCTCAACACGACGGTA CAGCTCAACACGACGGTAAGCTCAACACGACGGTA 11: 101,586,378 probably benign Het
Tmem131l A T 3: 83,905,076 C1313* probably null Het
Tmem86b A T 7: 4,629,699 I47N possibly damaging Het
Tspan13 T C 12: 36,020,551 probably null Het
Vps54 A G 11: 21,300,251 T396A probably benign Het
Zfp106 A T 2: 120,513,615 probably null Het
Zfp668 T C 7: 127,866,482 probably null Het
Zfp809 A T 9: 22,238,731 R175* probably null Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2008:Spef2 UTSW 15 9713185 missense possibly damaging 0.95
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9584207 missense probably benign 0.02
R7464:Spef2 UTSW 15 9740585 missense probably benign 0.23
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTAATGCTGCAAACTGGTTG -3'
(R):5'- CTGGACCAAAGAAAGAGGACATTTTAC -3'

Sequencing Primer
(F):5'- CAAACTGGTTGCCTTAGAACTATTG -3'
(R):5'- GGTAGCTTCTTTCTCTCTAGAG -3'
Posted On2014-06-30