Incidental Mutation 'R1876:Myom3'
ID211212
Institutional Source Beutler Lab
Gene Symbol Myom3
Ensembl Gene ENSMUSG00000037139
Gene Namemyomesin family, member 3
Synonyms8430427K15Rik
MMRRC Submission 039898-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R1876 (G1)
Quality Score142
Status Validated
Chromosome4
Chromosomal Location135759715-135815564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135779400 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 495 (F495I)
Ref Sequence ENSEMBL: ENSMUSP00000101480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105854]
Predicted Effect probably benign
Transcript: ENSMUST00000105854
AA Change: F495I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000101480
Gene: ENSMUSG00000037139
AA Change: F495I

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 53 83 N/A INTRINSIC
coiled coil region 119 150 N/A INTRINSIC
IG 160 248 7.64e-9 SMART
IG 277 364 1.37e-1 SMART
FN3 374 457 4.8e-13 SMART
FN3 502 585 9.99e-11 SMART
FN3 603 684 1.74e-10 SMART
FN3 702 785 2.5e-11 SMART
FN3 804 887 7.73e-17 SMART
Blast:IG_like 904 1098 1e-100 BLAST
PDB:2JTD|A 1000 1105 4e-25 PDB
low complexity region 1107 1119 N/A INTRINSIC
IG 1127 1209 4.46e-1 SMART
IGc2 1349 1416 1.4e-7 SMART
Meta Mutation Damage Score 0.048 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 99% (82/83)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,877,549 C961F probably damaging Het
Abca16 A C 7: 120,433,385 D209A probably damaging Het
Adamts14 T C 10: 61,200,372 I1047V probably benign Het
Ak1 A G 2: 32,630,270 K27E probably damaging Het
Akap9 T A 5: 3,961,809 D837E probably benign Het
Arfgef3 T C 10: 18,597,356 Y1653C probably damaging Het
Atad2 T G 15: 58,106,868 I446L probably benign Het
Atp8b3 T G 10: 80,530,078 T313P possibly damaging Het
Btg4 T C 9: 51,117,189 L72S probably damaging Het
Canx A G 11: 50,304,359 I294T probably damaging Het
Casp1 G A 9: 5,303,663 E250K probably benign Het
Chchd10 T A 10: 75,936,332 S46T probably benign Het
Col12a1 G T 9: 79,678,281 Y1271* probably null Het
Col3a1 G A 1: 45,342,235 probably null Het
Ctc1 A T 11: 69,031,564 T872S probably benign Het
Cx3cl1 T C 8: 94,780,420 F351S probably damaging Het
Cyb5r4 T A 9: 87,055,814 H295Q probably damaging Het
Cyp2j7 T C 4: 96,217,419 T285A probably benign Het
Dip2a G A 10: 76,318,091 T135M probably damaging Het
Fgf10 A G 13: 118,789,159 E158G probably damaging Het
Ftcd G T 10: 76,581,569 A281S probably benign Het
Gm16368 T G 12: 88,084,040 I115S probably damaging Het
Gpat4 A T 8: 23,179,470 M333K possibly damaging Het
Gpcpd1 A G 2: 132,534,753 L541P probably damaging Het
Grk5 T C 19: 61,083,225 Y408H probably damaging Het
Hcrtr2 A G 9: 76,246,345 probably null Het
Hsd17b13 T A 5: 103,968,767 N127I probably damaging Het
Hspa4 T G 11: 53,284,156 D158A probably benign Het
Ice2 G A 9: 69,415,575 A451T possibly damaging Het
Inpp5e A T 2: 26,408,157 I144K possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc49 T C 9: 60,587,777 I652V possibly damaging Het
Man1a A T 10: 53,919,172 W571R probably damaging Het
Mecom A G 3: 29,993,658 S32P probably damaging Het
Mrpl40 A G 16: 18,872,474 I162T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T C 15: 12,257,630 W265R probably damaging Het
Mup21 C T 4: 62,149,426 V79I probably benign Het
Myh11 G A 16: 14,269,103 probably benign Het
Ncoa7 A T 10: 30,698,126 probably benign Het
Nisch T C 14: 31,173,637 Y45C probably damaging Het
Nkain2 T A 10: 32,890,439 probably benign Het
Olfr356 A T 2: 36,937,763 I215F possibly damaging Het
Olfr728 A G 14: 50,140,172 S156P probably damaging Het
Pdcl A C 2: 37,355,696 H98Q probably damaging Het
Pink1 A G 4: 138,315,702 V427A probably damaging Het
Plce1 T C 19: 38,780,623 S2242P probably damaging Het
Plrg1 C A 3: 83,069,068 probably benign Het
Plxnc1 A G 10: 94,866,941 F586S possibly damaging Het
Pnpla7 G A 2: 25,040,973 V867M possibly damaging Het
Ppfia3 T A 7: 45,352,207 D427V possibly damaging Het
Ppp6r3 A T 19: 3,471,971 probably benign Het
Pros1 A T 16: 62,903,518 S210C probably damaging Het
Ptk2b A G 14: 66,158,392 S839P probably benign Het
Ptpre T C 7: 135,678,317 V570A possibly damaging Het
Rbm48 C T 5: 3,595,259 A142T probably damaging Het
Safb2 T C 17: 56,576,909 probably null Het
Scnn1a A G 6: 125,338,838 E384G probably benign Het
Sec23ip A G 7: 128,752,851 Y277C probably benign Het
Slc25a29 G A 12: 108,827,711 T42M probably damaging Het
Slc6a4 A T 11: 77,015,164 T264S probably benign Het
Srgap3 A G 6: 112,775,566 M319T probably damaging Het
Strn4 T A 7: 16,838,282 I640N probably damaging Het
Tacc2 A G 7: 130,623,745 D739G probably benign Het
Tigd4 T A 3: 84,593,935 L53* probably null Het
Tlr6 T A 5: 64,955,420 D48V probably damaging Het
Tmem125 T C 4: 118,541,904 D110G probably damaging Het
Tmem198 A G 1: 75,484,923 D341G probably damaging Het
Tnfaip3 A G 10: 19,004,934 F462L possibly damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ush2a T A 1: 188,678,289 I2378N possibly damaging Het
Usp47 A G 7: 112,054,920 T108A probably damaging Het
Vmn1r236 T A 17: 21,286,638 I6K probably benign Het
Vmn2r65 A T 7: 84,946,297 V393D probably damaging Het
Other mutations in Myom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Myom3 APN 4 135762571 missense possibly damaging 0.66
IGL01490:Myom3 APN 4 135810778 missense possibly damaging 0.79
IGL01931:Myom3 APN 4 135789639 missense probably benign 0.05
IGL01935:Myom3 APN 4 135788381 missense probably damaging 1.00
IGL01939:Myom3 APN 4 135765589 missense possibly damaging 0.95
IGL01981:Myom3 APN 4 135785849 nonsense probably null
IGL01985:Myom3 APN 4 135765702 critical splice donor site probably null
IGL02043:Myom3 APN 4 135770675 missense probably damaging 1.00
IGL02477:Myom3 APN 4 135779368 missense probably benign 0.22
IGL02733:Myom3 APN 4 135814303 nonsense probably null
IGL03253:Myom3 APN 4 135783097 missense possibly damaging 0.85
R0359:Myom3 UTSW 4 135778143 missense probably damaging 1.00
R0525:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0665:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0668:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0690:Myom3 UTSW 4 135788426 splice site probably benign
R1235:Myom3 UTSW 4 135789543 missense probably benign 0.09
R1692:Myom3 UTSW 4 135775551 missense probably benign 0.00
R1793:Myom3 UTSW 4 135810755 missense probably benign 0.42
R1859:Myom3 UTSW 4 135779396 missense probably benign 0.01
R1863:Myom3 UTSW 4 135778037 missense probably benign
R2103:Myom3 UTSW 4 135776412 missense probably benign 0.05
R2152:Myom3 UTSW 4 135803233 missense probably benign 0.05
R4633:Myom3 UTSW 4 135775699 missense probably benign 0.00
R4726:Myom3 UTSW 4 135807275 splice site probably null
R4884:Myom3 UTSW 4 135783055 missense possibly damaging 0.90
R4943:Myom3 UTSW 4 135814274 missense possibly damaging 0.73
R5040:Myom3 UTSW 4 135789659 missense probably damaging 1.00
R5151:Myom3 UTSW 4 135789572 missense probably benign 0.01
R5158:Myom3 UTSW 4 135765586 missense probably damaging 0.99
R5169:Myom3 UTSW 4 135775578 missense probably benign 0.01
R5239:Myom3 UTSW 4 135800992 splice site probably benign
R6130:Myom3 UTSW 4 135762571 missense probably benign
R6253:Myom3 UTSW 4 135785892 missense probably benign 0.07
R6253:Myom3 UTSW 4 135801003 missense probably benign 0.00
R6331:Myom3 UTSW 4 135776377 missense possibly damaging 0.46
R6346:Myom3 UTSW 4 135806051 missense probably benign 0.00
R6502:Myom3 UTSW 4 135762513 start gained probably benign
R6613:Myom3 UTSW 4 135812459 missense possibly damaging 0.80
R6899:Myom3 UTSW 4 135803292 missense probably damaging 1.00
R6969:Myom3 UTSW 4 135801060 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACATAGCCCCATGTGTCTG -3'
(R):5'- ACAGCCAGGCAGTCTAAAGG -3'

Sequencing Primer
(F):5'- TTTGGACTCCAAGAAAGCTAGAC -3'
(R):5'- GCAGTCTAAAGGACATGGCCC -3'
Posted On2014-06-30