Incidental Mutation 'R1876:Ctc1'
ID211253
Institutional Source Beutler Lab
Gene Symbol Ctc1
Ensembl Gene ENSMUSG00000020898
Gene NameCTS telomere maintenance complex component 1
Synonyms
MMRRC Submission 039898-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1876 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69015911-69036473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69031564 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 872 (T872S)
Ref Sequence ENSEMBL: ENSMUSP00000112063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021278] [ENSMUST00000116359] [ENSMUST00000152979] [ENSMUST00000161455]
Predicted Effect probably benign
Transcript: ENSMUST00000021278
AA Change: T871S

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021278
Gene: ENSMUSG00000020898
AA Change: T871S

DomainStartEndE-ValueType
Pfam:CTC1 60 1195 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116359
AA Change: T872S

PolyPhen 2 Score 0.243 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000112063
Gene: ENSMUSG00000020898
AA Change: T872S

DomainStartEndE-ValueType
Pfam:CTC1 61 1196 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143404
Predicted Effect probably benign
Transcript: ENSMUST00000152979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161384
Predicted Effect probably benign
Transcript: ENSMUST00000161455
AA Change: T625S

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124702
Gene: ENSMUSG00000020898
AA Change: T625S

DomainStartEndE-ValueType
Pfam:CTC1 1 949 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162256
Meta Mutation Damage Score 0.0892 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.1%
  • 20x: 92.2%
Validation Efficiency 99% (82/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the CST complex. This complex plays an essential role in protecting telomeres from degradation. This protein also forms a heterodimer with the CST complex subunit STN1 to form the enzyme alpha accessory factor. This enzyme regulates DNA replication. Mutations in this gene are the cause of cerebroretinal microangiopathy with calcifications and cysts. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit defective telomere replication that leads to stem cell exhaustion, bone marrow failure and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh C A 5: 76,877,549 C961F probably damaging Het
Abca16 A C 7: 120,433,385 D209A probably damaging Het
Adamts14 T C 10: 61,200,372 I1047V probably benign Het
Ak1 A G 2: 32,630,270 K27E probably damaging Het
Akap9 T A 5: 3,961,809 D837E probably benign Het
Arfgef3 T C 10: 18,597,356 Y1653C probably damaging Het
Atad2 T G 15: 58,106,868 I446L probably benign Het
Atp8b3 T G 10: 80,530,078 T313P possibly damaging Het
Btg4 T C 9: 51,117,189 L72S probably damaging Het
Canx A G 11: 50,304,359 I294T probably damaging Het
Casp1 G A 9: 5,303,663 E250K probably benign Het
Chchd10 T A 10: 75,936,332 S46T probably benign Het
Col12a1 G T 9: 79,678,281 Y1271* probably null Het
Col3a1 G A 1: 45,342,235 probably null Het
Cx3cl1 T C 8: 94,780,420 F351S probably damaging Het
Cyb5r4 T A 9: 87,055,814 H295Q probably damaging Het
Cyp2j7 T C 4: 96,217,419 T285A probably benign Het
Dip2a G A 10: 76,318,091 T135M probably damaging Het
Fgf10 A G 13: 118,789,159 E158G probably damaging Het
Ftcd G T 10: 76,581,569 A281S probably benign Het
Gm16368 T G 12: 88,084,040 I115S probably damaging Het
Gpat4 A T 8: 23,179,470 M333K possibly damaging Het
Gpcpd1 A G 2: 132,534,753 L541P probably damaging Het
Grk5 T C 19: 61,083,225 Y408H probably damaging Het
Hcrtr2 A G 9: 76,246,345 probably null Het
Hsd17b13 T A 5: 103,968,767 N127I probably damaging Het
Hspa4 T G 11: 53,284,156 D158A probably benign Het
Ice2 G A 9: 69,415,575 A451T possibly damaging Het
Inpp5e A T 2: 26,408,157 I144K possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc49 T C 9: 60,587,777 I652V possibly damaging Het
Man1a A T 10: 53,919,172 W571R probably damaging Het
Mecom A G 3: 29,993,658 S32P probably damaging Het
Mrpl40 A G 16: 18,872,474 I162T probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Mtmr12 T C 15: 12,257,630 W265R probably damaging Het
Mup21 C T 4: 62,149,426 V79I probably benign Het
Myh11 G A 16: 14,269,103 probably benign Het
Myom3 T A 4: 135,779,400 F495I probably benign Het
Ncoa7 A T 10: 30,698,126 probably benign Het
Nisch T C 14: 31,173,637 Y45C probably damaging Het
Nkain2 T A 10: 32,890,439 probably benign Het
Olfr356 A T 2: 36,937,763 I215F possibly damaging Het
Olfr728 A G 14: 50,140,172 S156P probably damaging Het
Pdcl A C 2: 37,355,696 H98Q probably damaging Het
Pink1 A G 4: 138,315,702 V427A probably damaging Het
Plce1 T C 19: 38,780,623 S2242P probably damaging Het
Plrg1 C A 3: 83,069,068 probably benign Het
Plxnc1 A G 10: 94,866,941 F586S possibly damaging Het
Pnpla7 G A 2: 25,040,973 V867M possibly damaging Het
Ppfia3 T A 7: 45,352,207 D427V possibly damaging Het
Ppp6r3 A T 19: 3,471,971 probably benign Het
Pros1 A T 16: 62,903,518 S210C probably damaging Het
Ptk2b A G 14: 66,158,392 S839P probably benign Het
Ptpre T C 7: 135,678,317 V570A possibly damaging Het
Rbm48 C T 5: 3,595,259 A142T probably damaging Het
Safb2 T C 17: 56,576,909 probably null Het
Scnn1a A G 6: 125,338,838 E384G probably benign Het
Sec23ip A G 7: 128,752,851 Y277C probably benign Het
Slc25a29 G A 12: 108,827,711 T42M probably damaging Het
Slc6a4 A T 11: 77,015,164 T264S probably benign Het
Srgap3 A G 6: 112,775,566 M319T probably damaging Het
Strn4 T A 7: 16,838,282 I640N probably damaging Het
Tacc2 A G 7: 130,623,745 D739G probably benign Het
Tigd4 T A 3: 84,593,935 L53* probably null Het
Tlr6 T A 5: 64,955,420 D48V probably damaging Het
Tmem125 T C 4: 118,541,904 D110G probably damaging Het
Tmem198 A G 1: 75,484,923 D341G probably damaging Het
Tnfaip3 A G 10: 19,004,934 F462L possibly damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Ush2a T A 1: 188,678,289 I2378N possibly damaging Het
Usp47 A G 7: 112,054,920 T108A probably damaging Het
Vmn1r236 T A 17: 21,286,638 I6K probably benign Het
Vmn2r65 A T 7: 84,946,297 V393D probably damaging Het
Other mutations in Ctc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02005:Ctc1 APN 11 69031149 missense probably damaging 1.00
IGL02135:Ctc1 APN 11 69021163 missense probably benign 0.25
IGL02164:Ctc1 APN 11 69026096 missense probably damaging 0.99
IGL02337:Ctc1 APN 11 69026131 missense probably damaging 1.00
IGL03149:Ctc1 APN 11 69031161 missense possibly damaging 0.55
PIT4810001:Ctc1 UTSW 11 69022526 missense probably benign 0.38
R0295:Ctc1 UTSW 11 69030588 missense possibly damaging 0.75
R0320:Ctc1 UTSW 11 69033537 missense probably damaging 1.00
R0496:Ctc1 UTSW 11 69035507 missense probably damaging 1.00
R1497:Ctc1 UTSW 11 69022561 missense probably benign 0.00
R1607:Ctc1 UTSW 11 69036150 missense possibly damaging 0.82
R1623:Ctc1 UTSW 11 69021142 missense probably damaging 0.99
R1856:Ctc1 UTSW 11 69034658 missense probably damaging 1.00
R1967:Ctc1 UTSW 11 69027862 critical splice acceptor site probably null
R2164:Ctc1 UTSW 11 69035615 missense possibly damaging 0.92
R2348:Ctc1 UTSW 11 69026191 missense probably benign 0.43
R2428:Ctc1 UTSW 11 69027701 missense possibly damaging 0.51
R3964:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R3965:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R3966:Ctc1 UTSW 11 69031128 missense probably damaging 1.00
R4398:Ctc1 UTSW 11 69022871 missense probably damaging 1.00
R4508:Ctc1 UTSW 11 69016117 splice site probably null
R4605:Ctc1 UTSW 11 69029726 missense possibly damaging 0.86
R4976:Ctc1 UTSW 11 69027326 missense probably damaging 1.00
R4979:Ctc1 UTSW 11 69033502 missense probably damaging 1.00
R5268:Ctc1 UTSW 11 69029810 missense possibly damaging 0.67
R6023:Ctc1 UTSW 11 69022607 missense probably benign 0.00
R6053:Ctc1 UTSW 11 69027901 missense probably benign 0.01
R7204:Ctc1 UTSW 11 69029741 missense probably damaging 1.00
R7252:Ctc1 UTSW 11 69026174 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTAGGAAGAAGTCAGCACG -3'
(R):5'- TCCTGCAGTGACAAGAAAGACTG -3'

Sequencing Primer
(F):5'- TTAGGCCTAGGCACATGCTGAG -3'
(R):5'- GACTGAAAGAGAACCCCCTCTC -3'
Posted On2014-06-30