Incidental Mutation 'R1878:Snapc4'
ID211278
Institutional Source Beutler Lab
Gene Symbol Snapc4
Ensembl Gene ENSMUSG00000036281
Gene Namesmall nuclear RNA activating complex, polypeptide 4
Synonyms5730436L13Rik
MMRRC Submission 039899-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1878 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26362765-26380653 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 26376153 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035427] [ENSMUST00000114115]
Predicted Effect probably null
Transcript: ENSMUST00000035427
SMART Domains Protein: ENSMUSP00000041767
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
low complexity region 33 52 N/A INTRINSIC
low complexity region 60 72 N/A INTRINSIC
coiled coil region 93 119 N/A INTRINSIC
low complexity region 200 212 N/A INTRINSIC
SANT 219 290 2.37e1 SMART
SANT 293 343 4.38e-10 SMART
SANT 345 397 3.05e-9 SMART
SANT 400 449 8.24e-15 SMART
SANT 452 501 7.8e-16 SMART
low complexity region 516 547 N/A INTRINSIC
Blast:SANT 550 753 1e-23 BLAST
low complexity region 893 909 N/A INTRINSIC
low complexity region 925 947 N/A INTRINSIC
low complexity region 971 983 N/A INTRINSIC
low complexity region 988 1007 N/A INTRINSIC
low complexity region 1157 1169 N/A INTRINSIC
low complexity region 1176 1190 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114115
SMART Domains Protein: ENSMUSP00000109750
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
coiled coil region 3 29 N/A INTRINSIC
low complexity region 41 60 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 101 127 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
SANT 227 298 2.37e1 SMART
SANT 301 351 4.38e-10 SMART
SANT 353 405 3.05e-9 SMART
SANT 408 457 8.24e-15 SMART
SANT 460 509 7.8e-16 SMART
low complexity region 524 555 N/A INTRINSIC
Blast:SANT 558 761 1e-23 BLAST
low complexity region 901 917 N/A INTRINSIC
low complexity region 933 955 N/A INTRINSIC
low complexity region 979 991 N/A INTRINSIC
low complexity region 996 1015 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1184 1198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123934
SMART Domains Protein: ENSMUSP00000122456
Gene: ENSMUSG00000036281

DomainStartEndE-ValueType
SANT 47 99 3.05e-9 SMART
SANT 102 151 8.24e-15 SMART
SANT 154 203 7.8e-16 SMART
low complexity region 218 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124843
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155643
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of the small nuclear RNA-activating protein (SNAP) complex. The encoded protein contains a Myb DNA-binding domain, and is essential for RNA polymerase II and III polymerase transcription from small nuclear RNA promoters. A mutation in this gene is associated with ankylosing spondylitis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,514,638 probably null Het
Abcb9 A G 5: 124,090,136 V14A probably benign Het
Adcy4 T C 14: 55,769,905 D950G probably damaging Het
Ahctf1 T C 1: 179,775,509 D828G possibly damaging Het
Ak2 T A 4: 129,002,167 V79D probably damaging Het
Arhgap29 T C 3: 122,011,371 Y870H probably damaging Het
Arid4a A G 12: 71,087,589 K1222E probably damaging Het
Armc1 A T 3: 19,157,544 D37E probably damaging Het
Cenpm A T 15: 82,234,415 M166K probably benign Het
Cep97 G T 16: 55,905,226 P766Q probably damaging Het
Col19a1 G T 1: 24,317,395 D672E probably benign Het
Col6a2 T C 10: 76,614,788 D103G probably benign Het
Ddi2 T C 4: 141,684,149 E484G probably benign Het
Dph1 T C 11: 75,184,227 D100G probably damaging Het
Dsp A T 13: 38,164,855 I100F possibly damaging Het
Fam222b T C 11: 78,143,216 probably null Het
Folh1 A T 7: 86,771,742 H126Q probably benign Het
Gapvd1 A T 2: 34,725,200 D428E probably benign Het
Gm11564 A T 11: 99,815,440 C55S unknown Het
Gm14139 T A 2: 150,193,069 C437S probably damaging Het
Gne T C 4: 44,040,434 I577V probably damaging Het
Gpr4 A G 7: 19,223,124 T324A probably damaging Het
Hhipl1 A T 12: 108,320,060 N542I possibly damaging Het
Ice2 T C 9: 69,428,576 probably null Het
Irgm1 C T 11: 48,866,070 V305I probably benign Het
Itgal C A 7: 127,310,671 Q73K probably benign Het
Jcad C A 18: 4,673,857 H540N possibly damaging Het
Jkamp T A 12: 72,094,104 V141D possibly damaging Het
Lrrc9 T C 12: 72,476,164 probably null Het
Mcc T C 18: 44,468,400 R621G possibly damaging Het
Myd88 T A 9: 119,338,620 Q140L probably benign Het
Mylk3 A T 8: 85,355,399 N323K possibly damaging Het
Myrip C T 9: 120,424,655 R265W probably damaging Het
N4bp1 A T 8: 86,861,541 S256R probably damaging Het
Nhsl1 T G 10: 18,524,279 S418A probably damaging Het
Nlrp9b A G 7: 20,028,564 T269A probably benign Het
Nmt1 A G 11: 103,052,251 N144S probably benign Het
Npvf G A 6: 50,654,323 T24I probably benign Het
Obscn T G 11: 58,995,553 Y2347S probably damaging Het
Olfr1202 A G 2: 88,817,461 T97A probably benign Het
Olfr125 T C 17: 37,835,362 V121A probably benign Het
Olfr135 T C 17: 38,208,374 I43T probably benign Het
Olfr170 G T 16: 19,605,751 Q306K probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr624 A C 7: 103,670,182 M283R probably damaging Het
Olfr8 T A 10: 78,955,805 M200K possibly damaging Het
Olfr975 T A 9: 39,950,757 T5S probably benign Het
Osgin2 A T 4: 16,005,493 V131D probably damaging Het
Pcdhac2 A T 18: 37,145,162 K398N possibly damaging Het
Pcnp A T 16: 56,018,487 M143K probably damaging Het
Ppp3ca A G 3: 136,797,878 I71V probably benign Het
Ppp4c G T 7: 126,787,607 R103S probably damaging Het
Prl2c2 T A 13: 13,005,326 M1L probably damaging Het
Recql5 A T 11: 115,895,101 D615E probably benign Het
Robo3 T C 9: 37,422,165 E728G probably damaging Het
Rps27l T A 9: 66,947,629 probably null Het
Scube3 T A 17: 28,152,413 V34E probably benign Het
Sez6l A G 5: 112,475,223 I154T probably damaging Het
Sgsm1 G A 5: 113,263,515 L782F probably damaging Het
Slc35c1 A G 2: 92,459,053 V36A probably benign Het
Sohlh2 C A 3: 55,207,643 R350S probably damaging Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sspo G A 6: 48,459,366 A1217T possibly damaging Het
Stil T C 4: 115,041,226 S1018P probably damaging Het
Strn T C 17: 78,677,326 E117G possibly damaging Het
Syt17 A T 7: 118,434,245 M180K probably benign Het
Trem1 T C 17: 48,241,488 S18P possibly damaging Het
Tsta3 A G 15: 75,925,369 S306P probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc80 A C 1: 66,509,402 H611P probably damaging Het
Zfp709 A G 8: 71,890,047 E440G probably damaging Het
Zfp764 C A 7: 127,405,042 A306S probably benign Het
Zfp949 T A 9: 88,569,303 S309T probably damaging Het
Zswim4 T C 8: 84,212,776 N826D possibly damaging Het
Other mutations in Snapc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Snapc4 APN 2 26369312 missense probably benign
IGL01730:Snapc4 APN 2 26363724 unclassified probably null
IGL01958:Snapc4 APN 2 26366440 unclassified probably benign
IGL02354:Snapc4 APN 2 26367307 unclassified probably benign
IGL02425:Snapc4 APN 2 26368200 missense probably damaging 1.00
IGL02812:Snapc4 APN 2 26369372 missense probably benign 0.03
IGL02951:Snapc4 APN 2 26370835 missense probably benign 0.33
R0011:Snapc4 UTSW 2 26364813 missense probably benign 0.03
R0409:Snapc4 UTSW 2 26367216 missense probably benign 0.37
R0932:Snapc4 UTSW 2 26374646 missense probably damaging 1.00
R1674:Snapc4 UTSW 2 26376197 missense probably benign
R3722:Snapc4 UTSW 2 26365428 missense probably benign
R3886:Snapc4 UTSW 2 26365498 nonsense probably null
R3887:Snapc4 UTSW 2 26365498 nonsense probably null
R3888:Snapc4 UTSW 2 26365498 nonsense probably null
R3889:Snapc4 UTSW 2 26365498 nonsense probably null
R4638:Snapc4 UTSW 2 26365302 missense probably damaging 1.00
R4663:Snapc4 UTSW 2 26374181 missense possibly damaging 0.77
R4879:Snapc4 UTSW 2 26365992 missense possibly damaging 0.93
R4922:Snapc4 UTSW 2 26369233 missense probably benign
R5385:Snapc4 UTSW 2 26374503 missense probably benign 0.44
R5525:Snapc4 UTSW 2 26369526 small deletion probably benign
R5762:Snapc4 UTSW 2 26378606 missense probably damaging 1.00
R5839:Snapc4 UTSW 2 26365534 missense probably benign 0.01
R6300:Snapc4 UTSW 2 26378551 missense probably benign 0.14
R6422:Snapc4 UTSW 2 26368303 missense probably benign 0.00
R6843:Snapc4 UTSW 2 26373599 missense probably benign 0.03
R7044:Snapc4 UTSW 2 26369953 missense probably damaging 1.00
R7341:Snapc4 UTSW 2 26369261 missense probably benign 0.01
X0010:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0011:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0014:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0017:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0021:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0023:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0028:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0033:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0064:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
X0067:Snapc4 UTSW 2 26369961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGCTAGACTCAGCCTGAAC -3'
(R):5'- CCATCTGGGCAGTACATGAG -3'

Sequencing Primer
(F):5'- CCACTCAACACTGGAGAGGG -3'
(R):5'- CTGGGCAGTACATGAGGAGGC -3'
Posted On2014-06-30