Incidental Mutation 'R1878:Gapvd1'
ID211279
Institutional Source Beutler Lab
Gene Symbol Gapvd1
Ensembl Gene ENSMUSG00000026867
Gene NameGTPase activating protein and VPS9 domains 1
Synonyms4432404J10Rik, 2010005B09Rik
MMRRC Submission 039899-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1878 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34674594-34755232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34725200 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 428 (D428E)
Ref Sequence ENSEMBL: ENSMUSP00000108723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028224] [ENSMUST00000102800] [ENSMUST00000113099] [ENSMUST00000142436]
Predicted Effect probably benign
Transcript: ENSMUST00000028224
AA Change: D428E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000028224
Gene: ENSMUSG00000026867
AA Change: D428E

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102800
AA Change: D428E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000099864
Gene: ENSMUSG00000026867
AA Change: D428E

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.3e-36 PFAM
internal_repeat_1 626 655 3.27e-5 PROSPERO
low complexity region 664 678 N/A INTRINSIC
internal_repeat_1 686 717 3.27e-5 PROSPERO
low complexity region 875 890 N/A INTRINSIC
low complexity region 909 920 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
low complexity region 936 952 N/A INTRINSIC
low complexity region 972 982 N/A INTRINSIC
VPS9 1332 1437 1.08e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113099
AA Change: D428E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000108723
Gene: ENSMUSG00000026867
AA Change: D428E

DomainStartEndE-ValueType
Pfam:RasGAP 152 353 2.8e-37 PFAM
internal_repeat_1 647 676 3.6e-5 PROSPERO
low complexity region 685 699 N/A INTRINSIC
internal_repeat_1 707 738 3.6e-5 PROSPERO
low complexity region 896 911 N/A INTRINSIC
low complexity region 930 941 N/A INTRINSIC
low complexity region 944 954 N/A INTRINSIC
low complexity region 957 973 N/A INTRINSIC
low complexity region 993 1003 N/A INTRINSIC
VPS9 1353 1458 1.08e-24 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113103
AA Change: D258E
SMART Domains Protein: ENSMUSP00000108727
Gene: ENSMUSG00000026867
AA Change: D258E

DomainStartEndE-ValueType
Pfam:RasGAP 1 184 4.9e-32 PFAM
internal_repeat_1 484 513 1.18e-5 PROSPERO
low complexity region 522 536 N/A INTRINSIC
internal_repeat_1 544 575 1.18e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137528
AA Change: D290E
SMART Domains Protein: ENSMUSP00000120138
Gene: ENSMUSG00000026867
AA Change: D290E

DomainStartEndE-ValueType
Pfam:RasGAP 15 216 1.2e-37 PFAM
internal_repeat_1 510 539 1.19e-5 PROSPERO
low complexity region 548 562 N/A INTRINSIC
internal_repeat_1 570 601 1.19e-5 PROSPERO
low complexity region 733 748 N/A INTRINSIC
low complexity region 767 778 N/A INTRINSIC
low complexity region 781 791 N/A INTRINSIC
low complexity region 794 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142436
SMART Domains Protein: ENSMUSP00000126225
Gene: ENSMUSG00000026867

DomainStartEndE-ValueType
SCOP:d1wer__ 95 135 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169207
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,514,638 probably null Het
Abcb9 A G 5: 124,090,136 V14A probably benign Het
Adcy4 T C 14: 55,769,905 D950G probably damaging Het
Ahctf1 T C 1: 179,775,509 D828G possibly damaging Het
Ak2 T A 4: 129,002,167 V79D probably damaging Het
Arhgap29 T C 3: 122,011,371 Y870H probably damaging Het
Arid4a A G 12: 71,087,589 K1222E probably damaging Het
Armc1 A T 3: 19,157,544 D37E probably damaging Het
Cenpm A T 15: 82,234,415 M166K probably benign Het
Cep97 G T 16: 55,905,226 P766Q probably damaging Het
Col19a1 G T 1: 24,317,395 D672E probably benign Het
Col6a2 T C 10: 76,614,788 D103G probably benign Het
Ddi2 T C 4: 141,684,149 E484G probably benign Het
Dph1 T C 11: 75,184,227 D100G probably damaging Het
Dsp A T 13: 38,164,855 I100F possibly damaging Het
Fam222b T C 11: 78,143,216 probably null Het
Folh1 A T 7: 86,771,742 H126Q probably benign Het
Gm11564 A T 11: 99,815,440 C55S unknown Het
Gm14139 T A 2: 150,193,069 C437S probably damaging Het
Gne T C 4: 44,040,434 I577V probably damaging Het
Gpr4 A G 7: 19,223,124 T324A probably damaging Het
Hhipl1 A T 12: 108,320,060 N542I possibly damaging Het
Ice2 T C 9: 69,428,576 probably null Het
Irgm1 C T 11: 48,866,070 V305I probably benign Het
Itgal C A 7: 127,310,671 Q73K probably benign Het
Jcad C A 18: 4,673,857 H540N possibly damaging Het
Jkamp T A 12: 72,094,104 V141D possibly damaging Het
Lrrc9 T C 12: 72,476,164 probably null Het
Mcc T C 18: 44,468,400 R621G possibly damaging Het
Myd88 T A 9: 119,338,620 Q140L probably benign Het
Mylk3 A T 8: 85,355,399 N323K possibly damaging Het
Myrip C T 9: 120,424,655 R265W probably damaging Het
N4bp1 A T 8: 86,861,541 S256R probably damaging Het
Nhsl1 T G 10: 18,524,279 S418A probably damaging Het
Nlrp9b A G 7: 20,028,564 T269A probably benign Het
Nmt1 A G 11: 103,052,251 N144S probably benign Het
Npvf G A 6: 50,654,323 T24I probably benign Het
Obscn T G 11: 58,995,553 Y2347S probably damaging Het
Olfr1202 A G 2: 88,817,461 T97A probably benign Het
Olfr125 T C 17: 37,835,362 V121A probably benign Het
Olfr135 T C 17: 38,208,374 I43T probably benign Het
Olfr170 G T 16: 19,605,751 Q306K probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr624 A C 7: 103,670,182 M283R probably damaging Het
Olfr8 T A 10: 78,955,805 M200K possibly damaging Het
Olfr975 T A 9: 39,950,757 T5S probably benign Het
Osgin2 A T 4: 16,005,493 V131D probably damaging Het
Pcdhac2 A T 18: 37,145,162 K398N possibly damaging Het
Pcnp A T 16: 56,018,487 M143K probably damaging Het
Ppp3ca A G 3: 136,797,878 I71V probably benign Het
Ppp4c G T 7: 126,787,607 R103S probably damaging Het
Prl2c2 T A 13: 13,005,326 M1L probably damaging Het
Recql5 A T 11: 115,895,101 D615E probably benign Het
Robo3 T C 9: 37,422,165 E728G probably damaging Het
Rps27l T A 9: 66,947,629 probably null Het
Scube3 T A 17: 28,152,413 V34E probably benign Het
Sez6l A G 5: 112,475,223 I154T probably damaging Het
Sgsm1 G A 5: 113,263,515 L782F probably damaging Het
Slc35c1 A G 2: 92,459,053 V36A probably benign Het
Snapc4 A G 2: 26,376,153 probably null Het
Sohlh2 C A 3: 55,207,643 R350S probably damaging Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sspo G A 6: 48,459,366 A1217T possibly damaging Het
Stil T C 4: 115,041,226 S1018P probably damaging Het
Strn T C 17: 78,677,326 E117G possibly damaging Het
Syt17 A T 7: 118,434,245 M180K probably benign Het
Trem1 T C 17: 48,241,488 S18P possibly damaging Het
Tsta3 A G 15: 75,925,369 S306P probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc80 A C 1: 66,509,402 H611P probably damaging Het
Zfp709 A G 8: 71,890,047 E440G probably damaging Het
Zfp764 C A 7: 127,405,042 A306S probably benign Het
Zfp949 T A 9: 88,569,303 S309T probably damaging Het
Zswim4 T C 8: 84,212,776 N826D possibly damaging Het
Other mutations in Gapvd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Gapvd1 APN 2 34699860 missense probably benign 0.00
IGL00985:Gapvd1 APN 2 34695563 missense probably damaging 0.99
IGL01133:Gapvd1 APN 2 34725398 missense probably damaging 0.98
IGL01347:Gapvd1 APN 2 34706696 critical splice donor site probably null
IGL01830:Gapvd1 APN 2 34688956 missense probably benign 0.44
IGL01865:Gapvd1 APN 2 34695503 missense probably null
IGL02009:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02014:Gapvd1 APN 2 34704191 missense probably damaging 1.00
IGL02189:Gapvd1 APN 2 34728544 missense probably damaging 1.00
IGL02418:Gapvd1 APN 2 34730518 missense probably benign 0.00
IGL02632:Gapvd1 APN 2 34684174 splice site probably benign
IGL02636:Gapvd1 APN 2 34725404 missense probably benign 0.01
IGL02643:Gapvd1 APN 2 34704180 missense probably damaging 1.00
IGL03271:Gapvd1 APN 2 34727207 unclassified probably benign
P0023:Gapvd1 UTSW 2 34706688 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0016:Gapvd1 UTSW 2 34699913 splice site probably benign
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0029:Gapvd1 UTSW 2 34678141 missense probably damaging 1.00
R0282:Gapvd1 UTSW 2 34688960 nonsense probably null
R0414:Gapvd1 UTSW 2 34693427 missense probably benign 0.14
R0443:Gapvd1 UTSW 2 34704621 intron probably benign
R0542:Gapvd1 UTSW 2 34725036 unclassified probably benign
R0570:Gapvd1 UTSW 2 34728540 missense probably damaging 1.00
R0840:Gapvd1 UTSW 2 34729113 missense probably benign 0.29
R0866:Gapvd1 UTSW 2 34709217 missense probably damaging 1.00
R0890:Gapvd1 UTSW 2 34712317 missense probably damaging 1.00
R0926:Gapvd1 UTSW 2 34712325 missense probably damaging 1.00
R0970:Gapvd1 UTSW 2 34730613 unclassified probably null
R1168:Gapvd1 UTSW 2 34704469 missense probably damaging 1.00
R1391:Gapvd1 UTSW 2 34706802 missense probably damaging 1.00
R1577:Gapvd1 UTSW 2 34709228 missense probably damaging 1.00
R1585:Gapvd1 UTSW 2 34712195 missense possibly damaging 0.93
R1669:Gapvd1 UTSW 2 34730682 critical splice acceptor site probably null
R1677:Gapvd1 UTSW 2 34700761 critical splice donor site probably null
R1812:Gapvd1 UTSW 2 34725064 nonsense probably null
R1874:Gapvd1 UTSW 2 34706021 missense probably damaging 1.00
R1974:Gapvd1 UTSW 2 34700841 missense probably damaging 0.99
R2111:Gapvd1 UTSW 2 34684317 missense probably benign 0.08
R2921:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R2923:Gapvd1 UTSW 2 34688863 missense probably damaging 0.97
R3846:Gapvd1 UTSW 2 34729072 nonsense probably null
R3894:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R4405:Gapvd1 UTSW 2 34728735 missense probably damaging 1.00
R4605:Gapvd1 UTSW 2 34728537 missense probably damaging 1.00
R4770:Gapvd1 UTSW 2 34691181 missense probably damaging 0.98
R4935:Gapvd1 UTSW 2 34704492 nonsense probably null
R5218:Gapvd1 UTSW 2 34728476 missense probably benign 0.23
R5490:Gapvd1 UTSW 2 34693433 missense probably benign 0.23
R5571:Gapvd1 UTSW 2 34715253 missense probably damaging 1.00
R5588:Gapvd1 UTSW 2 34709154 missense probably damaging 1.00
R5933:Gapvd1 UTSW 2 34684291 missense probably benign 0.27
R6117:Gapvd1 UTSW 2 34690459 splice site probably null
R6661:Gapvd1 UTSW 2 34728438 missense probably damaging 1.00
R6857:Gapvd1 UTSW 2 34728377 missense probably damaging 1.00
R6950:Gapvd1 UTSW 2 34684245 missense probably benign 0.04
R7009:Gapvd1 UTSW 2 34700817 missense probably damaging 1.00
R7125:Gapvd1 UTSW 2 34695600 missense probably benign
R7154:Gapvd1 UTSW 2 34725063 missense probably damaging 1.00
R7316:Gapvd1 UTSW 2 34704669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGCAGGTTCTCCTTACCTATAGG -3'
(R):5'- GCTTGAGCAGAACTGTGGTG -3'

Sequencing Primer
(F):5'- ATAGGTAATCGATTCTTCTTGTTGGC -3'
(R):5'- CAGCTTATTACTCTGGTAATGGC -3'
Posted On2014-06-30