Incidental Mutation 'R1878:Slc35c1'
ID211283
Institutional Source Beutler Lab
Gene Symbol Slc35c1
Ensembl Gene ENSMUSG00000049922
Gene Namesolute carrier family 35, member C1
SynonymsFUCT1, E430007K15Rik
MMRRC Submission 039899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R1878 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location92452764-92460538 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92459053 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 36 (V36A)
Ref Sequence ENSEMBL: ENSMUSP00000137748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067631] [ENSMUST00000125276] [ENSMUST00000136718]
Predicted Effect probably benign
Transcript: ENSMUST00000067631
AA Change: V49A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000063461
Gene: ENSMUSG00000049922
AA Change: V49A

DomainStartEndE-ValueType
low complexity region 23 28 N/A INTRINSIC
Pfam:TPT 38 336 5.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125276
AA Change: V36A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000119271
Gene: ENSMUSG00000049922
AA Change: V36A

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
Pfam:UAA 27 330 2e-11 PFAM
Pfam:TPT 184 325 3.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136718
AA Change: V36A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000137748
Gene: ENSMUSG00000049922
AA Change: V36A

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
Pfam:UAA 27 158 4.5e-7 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GDP-fucose transporter that is found in the Golgi apparatus. Mutations in this gene result in congenital disorder of glycosylation type IIc. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit partial perinatal and postnatal lethality, growth retardation, reduced fertility, leukocytosis, defective lung and primary lymph node development and altered lymphocyte rolling and adhesion. Mortality is increased on an inbred background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,514,638 probably null Het
Abcb9 A G 5: 124,090,136 V14A probably benign Het
Adcy4 T C 14: 55,769,905 D950G probably damaging Het
Ahctf1 T C 1: 179,775,509 D828G possibly damaging Het
Ak2 T A 4: 129,002,167 V79D probably damaging Het
Arhgap29 T C 3: 122,011,371 Y870H probably damaging Het
Arid4a A G 12: 71,087,589 K1222E probably damaging Het
Armc1 A T 3: 19,157,544 D37E probably damaging Het
Cenpm A T 15: 82,234,415 M166K probably benign Het
Cep97 G T 16: 55,905,226 P766Q probably damaging Het
Col19a1 G T 1: 24,317,395 D672E probably benign Het
Col6a2 T C 10: 76,614,788 D103G probably benign Het
Ddi2 T C 4: 141,684,149 E484G probably benign Het
Dph1 T C 11: 75,184,227 D100G probably damaging Het
Dsp A T 13: 38,164,855 I100F possibly damaging Het
Fam222b T C 11: 78,143,216 probably null Het
Folh1 A T 7: 86,771,742 H126Q probably benign Het
Gapvd1 A T 2: 34,725,200 D428E probably benign Het
Gm11564 A T 11: 99,815,440 C55S unknown Het
Gm14139 T A 2: 150,193,069 C437S probably damaging Het
Gne T C 4: 44,040,434 I577V probably damaging Het
Gpr4 A G 7: 19,223,124 T324A probably damaging Het
Hhipl1 A T 12: 108,320,060 N542I possibly damaging Het
Ice2 T C 9: 69,428,576 probably null Het
Irgm1 C T 11: 48,866,070 V305I probably benign Het
Itgal C A 7: 127,310,671 Q73K probably benign Het
Jcad C A 18: 4,673,857 H540N possibly damaging Het
Jkamp T A 12: 72,094,104 V141D possibly damaging Het
Lrrc9 T C 12: 72,476,164 probably null Het
Mcc T C 18: 44,468,400 R621G possibly damaging Het
Myd88 T A 9: 119,338,620 Q140L probably benign Het
Mylk3 A T 8: 85,355,399 N323K possibly damaging Het
Myrip C T 9: 120,424,655 R265W probably damaging Het
N4bp1 A T 8: 86,861,541 S256R probably damaging Het
Nhsl1 T G 10: 18,524,279 S418A probably damaging Het
Nlrp9b A G 7: 20,028,564 T269A probably benign Het
Nmt1 A G 11: 103,052,251 N144S probably benign Het
Npvf G A 6: 50,654,323 T24I probably benign Het
Obscn T G 11: 58,995,553 Y2347S probably damaging Het
Olfr1202 A G 2: 88,817,461 T97A probably benign Het
Olfr125 T C 17: 37,835,362 V121A probably benign Het
Olfr135 T C 17: 38,208,374 I43T probably benign Het
Olfr170 G T 16: 19,605,751 Q306K probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr624 A C 7: 103,670,182 M283R probably damaging Het
Olfr8 T A 10: 78,955,805 M200K possibly damaging Het
Olfr975 T A 9: 39,950,757 T5S probably benign Het
Osgin2 A T 4: 16,005,493 V131D probably damaging Het
Pcdhac2 A T 18: 37,145,162 K398N possibly damaging Het
Pcnp A T 16: 56,018,487 M143K probably damaging Het
Ppp3ca A G 3: 136,797,878 I71V probably benign Het
Ppp4c G T 7: 126,787,607 R103S probably damaging Het
Prl2c2 T A 13: 13,005,326 M1L probably damaging Het
Recql5 A T 11: 115,895,101 D615E probably benign Het
Robo3 T C 9: 37,422,165 E728G probably damaging Het
Rps27l T A 9: 66,947,629 probably null Het
Scube3 T A 17: 28,152,413 V34E probably benign Het
Sez6l A G 5: 112,475,223 I154T probably damaging Het
Sgsm1 G A 5: 113,263,515 L782F probably damaging Het
Snapc4 A G 2: 26,376,153 probably null Het
Sohlh2 C A 3: 55,207,643 R350S probably damaging Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sspo G A 6: 48,459,366 A1217T possibly damaging Het
Stil T C 4: 115,041,226 S1018P probably damaging Het
Strn T C 17: 78,677,326 E117G possibly damaging Het
Syt17 A T 7: 118,434,245 M180K probably benign Het
Trem1 T C 17: 48,241,488 S18P possibly damaging Het
Tsta3 A G 15: 75,925,369 S306P probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc80 A C 1: 66,509,402 H611P probably damaging Het
Zfp709 A G 8: 71,890,047 E440G probably damaging Het
Zfp764 C A 7: 127,405,042 A306S probably benign Het
Zfp949 T A 9: 88,569,303 S309T probably damaging Het
Zswim4 T C 8: 84,212,776 N826D possibly damaging Het
Other mutations in Slc35c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Slc35c1 APN 2 92454358 missense probably benign 0.00
IGL00931:Slc35c1 APN 2 92458894 missense probably benign 0.00
R0350:Slc35c1 UTSW 2 92459032 missense probably damaging 1.00
R0458:Slc35c1 UTSW 2 92454513 missense probably damaging 0.98
R0589:Slc35c1 UTSW 2 92454514 missense probably damaging 0.98
R1997:Slc35c1 UTSW 2 92454639 missense probably benign 0.04
R2329:Slc35c1 UTSW 2 92458695 nonsense probably null
R2473:Slc35c1 UTSW 2 92454753 missense probably benign 0.32
R2568:Slc35c1 UTSW 2 92458880 missense probably benign 0.00
R4583:Slc35c1 UTSW 2 92458921 missense probably damaging 1.00
R4761:Slc35c1 UTSW 2 92458823 missense probably damaging 0.99
R5021:Slc35c1 UTSW 2 92459021 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TGCCGATAAAGACCACTGACAG -3'
(R):5'- TAAGGTGACCCAGCTCTTCTGC -3'

Sequencing Primer
(F):5'- ACACTTCGGGCCACCTTGAG -3'
(R):5'- TCTTCTGCCACCATGAACAGGG -3'
Posted On2014-06-30