Incidental Mutation 'R1878:Gne'
ID211290
Institutional Source Beutler Lab
Gene Symbol Gne
Ensembl Gene ENSMUSG00000028479
Gene Nameglucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms
MMRRC Submission 039899-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1878 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location44034075-44084177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44040434 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 577 (I577V)
Ref Sequence ENSEMBL: ENSMUSP00000030201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030201] [ENSMUST00000102936] [ENSMUST00000172533] [ENSMUST00000173234]
Predicted Effect probably damaging
Transcript: ENSMUST00000030201
AA Change: I577V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030201
Gene: ENSMUSG00000028479
AA Change: I577V

DomainStartEndE-ValueType
Pfam:Epimerase_2 63 406 2.3e-69 PFAM
Pfam:ROK 440 747 1.4e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102936
AA Change: I546V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000100000
Gene: ENSMUSG00000028479
AA Change: I546V

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 5.1e-75 PFAM
Pfam:ROK 411 596 6.5e-44 PFAM
low complexity region 685 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172533
SMART Domains Protein: ENSMUSP00000134040
Gene: ENSMUSG00000028479

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 1.6e-75 PFAM
PDB:3EO3|C 406 471 2e-33 PDB
SCOP:d1bu6o1 410 462 1e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173234
AA Change: I472V

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000133521
Gene: ENSMUSG00000028479
AA Change: I472V

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 3.9e-75 PFAM
Pfam:ROK 453 522 1.6e-16 PFAM
low complexity region 611 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174522
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes a block in sialic acid biosynthesis and early embryonic lethality. A knockout mouse expressing the human V572L mutation shows features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,514,638 probably null Het
Abcb9 A G 5: 124,090,136 V14A probably benign Het
Adcy4 T C 14: 55,769,905 D950G probably damaging Het
Ahctf1 T C 1: 179,775,509 D828G possibly damaging Het
Ak2 T A 4: 129,002,167 V79D probably damaging Het
Arhgap29 T C 3: 122,011,371 Y870H probably damaging Het
Arid4a A G 12: 71,087,589 K1222E probably damaging Het
Armc1 A T 3: 19,157,544 D37E probably damaging Het
Cenpm A T 15: 82,234,415 M166K probably benign Het
Cep97 G T 16: 55,905,226 P766Q probably damaging Het
Col19a1 G T 1: 24,317,395 D672E probably benign Het
Col6a2 T C 10: 76,614,788 D103G probably benign Het
Ddi2 T C 4: 141,684,149 E484G probably benign Het
Dph1 T C 11: 75,184,227 D100G probably damaging Het
Dsp A T 13: 38,164,855 I100F possibly damaging Het
Fam222b T C 11: 78,143,216 probably null Het
Folh1 A T 7: 86,771,742 H126Q probably benign Het
Gapvd1 A T 2: 34,725,200 D428E probably benign Het
Gm11564 A T 11: 99,815,440 C55S unknown Het
Gm14139 T A 2: 150,193,069 C437S probably damaging Het
Gpr4 A G 7: 19,223,124 T324A probably damaging Het
Hhipl1 A T 12: 108,320,060 N542I possibly damaging Het
Ice2 T C 9: 69,428,576 probably null Het
Irgm1 C T 11: 48,866,070 V305I probably benign Het
Itgal C A 7: 127,310,671 Q73K probably benign Het
Jcad C A 18: 4,673,857 H540N possibly damaging Het
Jkamp T A 12: 72,094,104 V141D possibly damaging Het
Lrrc9 T C 12: 72,476,164 probably null Het
Mcc T C 18: 44,468,400 R621G possibly damaging Het
Myd88 T A 9: 119,338,620 Q140L probably benign Het
Mylk3 A T 8: 85,355,399 N323K possibly damaging Het
Myrip C T 9: 120,424,655 R265W probably damaging Het
N4bp1 A T 8: 86,861,541 S256R probably damaging Het
Nhsl1 T G 10: 18,524,279 S418A probably damaging Het
Nlrp9b A G 7: 20,028,564 T269A probably benign Het
Nmt1 A G 11: 103,052,251 N144S probably benign Het
Npvf G A 6: 50,654,323 T24I probably benign Het
Obscn T G 11: 58,995,553 Y2347S probably damaging Het
Olfr1202 A G 2: 88,817,461 T97A probably benign Het
Olfr125 T C 17: 37,835,362 V121A probably benign Het
Olfr135 T C 17: 38,208,374 I43T probably benign Het
Olfr170 G T 16: 19,605,751 Q306K probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr624 A C 7: 103,670,182 M283R probably damaging Het
Olfr8 T A 10: 78,955,805 M200K possibly damaging Het
Olfr975 T A 9: 39,950,757 T5S probably benign Het
Osgin2 A T 4: 16,005,493 V131D probably damaging Het
Pcdhac2 A T 18: 37,145,162 K398N possibly damaging Het
Pcnp A T 16: 56,018,487 M143K probably damaging Het
Ppp3ca A G 3: 136,797,878 I71V probably benign Het
Ppp4c G T 7: 126,787,607 R103S probably damaging Het
Prl2c2 T A 13: 13,005,326 M1L probably damaging Het
Recql5 A T 11: 115,895,101 D615E probably benign Het
Robo3 T C 9: 37,422,165 E728G probably damaging Het
Rps27l T A 9: 66,947,629 probably null Het
Scube3 T A 17: 28,152,413 V34E probably benign Het
Sez6l A G 5: 112,475,223 I154T probably damaging Het
Sgsm1 G A 5: 113,263,515 L782F probably damaging Het
Slc35c1 A G 2: 92,459,053 V36A probably benign Het
Snapc4 A G 2: 26,376,153 probably null Het
Sohlh2 C A 3: 55,207,643 R350S probably damaging Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sspo G A 6: 48,459,366 A1217T possibly damaging Het
Stil T C 4: 115,041,226 S1018P probably damaging Het
Strn T C 17: 78,677,326 E117G possibly damaging Het
Syt17 A T 7: 118,434,245 M180K probably benign Het
Trem1 T C 17: 48,241,488 S18P possibly damaging Het
Tsta3 A G 15: 75,925,369 S306P probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc80 A C 1: 66,509,402 H611P probably damaging Het
Zfp709 A G 8: 71,890,047 E440G probably damaging Het
Zfp764 C A 7: 127,405,042 A306S probably benign Het
Zfp949 T A 9: 88,569,303 S309T probably damaging Het
Zswim4 T C 8: 84,212,776 N826D possibly damaging Het
Other mutations in Gne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Gne APN 4 44041860 intron probably null
IGL02028:Gne APN 4 44066852 missense probably damaging 1.00
IGL02106:Gne APN 4 44037306 missense probably damaging 1.00
IGL02216:Gne APN 4 44044761 missense probably benign 0.43
IGL03095:Gne APN 4 44055211 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0310:Gne UTSW 4 44060157 nonsense probably null
R0606:Gne UTSW 4 44042244 missense possibly damaging 0.55
R0658:Gne UTSW 4 44039033 missense possibly damaging 0.85
R2009:Gne UTSW 4 44055273 missense probably benign 0.00
R2338:Gne UTSW 4 44042196 missense probably damaging 0.99
R4043:Gne UTSW 4 44040383 missense possibly damaging 0.65
R4361:Gne UTSW 4 44059947 missense possibly damaging 0.63
R4725:Gne UTSW 4 44066806 missense probably benign 0.31
R4869:Gne UTSW 4 44055204 critical splice donor site probably null
R5511:Gne UTSW 4 44041843 missense probably damaging 0.99
R5797:Gne UTSW 4 44060030 missense probably damaging 1.00
R6016:Gne UTSW 4 44039063 missense probably damaging 0.99
R6176:Gne UTSW 4 44053019 intron probably benign
R6461:Gne UTSW 4 44060078 missense probably damaging 1.00
R6804:Gne UTSW 4 44060210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTGCCATTCGGTTAGTGAC -3'
(R):5'- CGAGACCTCAGAAGATGTGC -3'

Sequencing Primer
(F):5'- GTGACTTCCATAGGTGACAGATACC -3'
(R):5'- GATGTGCTTCAAACACTGCC -3'
Posted On2014-06-30