Incidental Mutation 'R1878:Dph1'
ID211327
Institutional Source Beutler Lab
Gene Symbol Dph1
Ensembl Gene ENSMUSG00000078789
Gene Namediphthamide biosynthesis 1
Synonyms4930488F09Rik, Ovca1, Dph2l1
MMRRC Submission 039899-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1878 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location75177643-75191241 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75184227 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 100 (D100G)
Ref Sequence ENSEMBL: ENSMUSP00000116537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044949] [ENSMUST00000139958]
Predicted Effect probably damaging
Transcript: ENSMUST00000044949
AA Change: D114G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042162
Gene: ENSMUSG00000078789
AA Change: D114G

DomainStartEndE-ValueType
Pfam:Diphthamide_syn 76 377 5.3e-123 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139958
AA Change: D100G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116537
Gene: ENSMUSG00000078789
AA Change: D100G

DomainStartEndE-ValueType
Pfam:Diphthamide_syn 62 276 1.1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156489
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme involved in the biosynthesis of diphthamide, a modified histidine found only in elongation factor-2 (EEF2). Diphthamide residues in EEF2 are targeted for ADP-ribosylation by diphtheria toxin and Pseudomonas exotoxin A. Defects in this gene have been associated with both ovarian cancer and autosomal recessive intellectual disability with short stature, craniofacial, and ectodermal anomalies. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene die perinatally of respiratory distress or earlier. Numerous systems are affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,514,638 probably null Het
Abcb9 A G 5: 124,090,136 V14A probably benign Het
Adcy4 T C 14: 55,769,905 D950G probably damaging Het
Ahctf1 T C 1: 179,775,509 D828G possibly damaging Het
Ak2 T A 4: 129,002,167 V79D probably damaging Het
Arhgap29 T C 3: 122,011,371 Y870H probably damaging Het
Arid4a A G 12: 71,087,589 K1222E probably damaging Het
Armc1 A T 3: 19,157,544 D37E probably damaging Het
Cenpm A T 15: 82,234,415 M166K probably benign Het
Cep97 G T 16: 55,905,226 P766Q probably damaging Het
Col19a1 G T 1: 24,317,395 D672E probably benign Het
Col6a2 T C 10: 76,614,788 D103G probably benign Het
Ddi2 T C 4: 141,684,149 E484G probably benign Het
Dsp A T 13: 38,164,855 I100F possibly damaging Het
Fam222b T C 11: 78,143,216 probably null Het
Folh1 A T 7: 86,771,742 H126Q probably benign Het
Gapvd1 A T 2: 34,725,200 D428E probably benign Het
Gm11564 A T 11: 99,815,440 C55S unknown Het
Gm14139 T A 2: 150,193,069 C437S probably damaging Het
Gne T C 4: 44,040,434 I577V probably damaging Het
Gpr4 A G 7: 19,223,124 T324A probably damaging Het
Hhipl1 A T 12: 108,320,060 N542I possibly damaging Het
Ice2 T C 9: 69,428,576 probably null Het
Irgm1 C T 11: 48,866,070 V305I probably benign Het
Itgal C A 7: 127,310,671 Q73K probably benign Het
Jcad C A 18: 4,673,857 H540N possibly damaging Het
Jkamp T A 12: 72,094,104 V141D possibly damaging Het
Lrrc9 T C 12: 72,476,164 probably null Het
Mcc T C 18: 44,468,400 R621G possibly damaging Het
Myd88 T A 9: 119,338,620 Q140L probably benign Het
Mylk3 A T 8: 85,355,399 N323K possibly damaging Het
Myrip C T 9: 120,424,655 R265W probably damaging Het
N4bp1 A T 8: 86,861,541 S256R probably damaging Het
Nhsl1 T G 10: 18,524,279 S418A probably damaging Het
Nlrp9b A G 7: 20,028,564 T269A probably benign Het
Nmt1 A G 11: 103,052,251 N144S probably benign Het
Npvf G A 6: 50,654,323 T24I probably benign Het
Obscn T G 11: 58,995,553 Y2347S probably damaging Het
Olfr1202 A G 2: 88,817,461 T97A probably benign Het
Olfr125 T C 17: 37,835,362 V121A probably benign Het
Olfr135 T C 17: 38,208,374 I43T probably benign Het
Olfr170 G T 16: 19,605,751 Q306K probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr624 A C 7: 103,670,182 M283R probably damaging Het
Olfr8 T A 10: 78,955,805 M200K possibly damaging Het
Olfr975 T A 9: 39,950,757 T5S probably benign Het
Osgin2 A T 4: 16,005,493 V131D probably damaging Het
Pcdhac2 A T 18: 37,145,162 K398N possibly damaging Het
Pcnp A T 16: 56,018,487 M143K probably damaging Het
Ppp3ca A G 3: 136,797,878 I71V probably benign Het
Ppp4c G T 7: 126,787,607 R103S probably damaging Het
Prl2c2 T A 13: 13,005,326 M1L probably damaging Het
Recql5 A T 11: 115,895,101 D615E probably benign Het
Robo3 T C 9: 37,422,165 E728G probably damaging Het
Rps27l T A 9: 66,947,629 probably null Het
Scube3 T A 17: 28,152,413 V34E probably benign Het
Sez6l A G 5: 112,475,223 I154T probably damaging Het
Sgsm1 G A 5: 113,263,515 L782F probably damaging Het
Slc35c1 A G 2: 92,459,053 V36A probably benign Het
Snapc4 A G 2: 26,376,153 probably null Het
Sohlh2 C A 3: 55,207,643 R350S probably damaging Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sspo G A 6: 48,459,366 A1217T possibly damaging Het
Stil T C 4: 115,041,226 S1018P probably damaging Het
Strn T C 17: 78,677,326 E117G possibly damaging Het
Syt17 A T 7: 118,434,245 M180K probably benign Het
Trem1 T C 17: 48,241,488 S18P possibly damaging Het
Tsta3 A G 15: 75,925,369 S306P probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc80 A C 1: 66,509,402 H611P probably damaging Het
Zfp709 A G 8: 71,890,047 E440G probably damaging Het
Zfp764 C A 7: 127,405,042 A306S probably benign Het
Zfp949 T A 9: 88,569,303 S309T probably damaging Het
Zswim4 T C 8: 84,212,776 N826D possibly damaging Het
Other mutations in Dph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Dph1 APN 11 75180949 splice site probably benign
IGL01317:Dph1 APN 11 75180660 missense probably benign 0.00
IGL01872:Dph1 APN 11 75181341 missense probably damaging 1.00
IGL02036:Dph1 APN 11 75184165 splice site probably null
IGL02386:Dph1 APN 11 75183602 missense probably benign 0.00
IGL02658:Dph1 APN 11 75180635 missense probably benign 0.08
IGL02985:Dph1 APN 11 75183593 missense possibly damaging 0.67
R0610:Dph1 UTSW 11 75185957 splice site probably benign
R1847:Dph1 UTSW 11 75179731 missense probably damaging 0.96
R2037:Dph1 UTSW 11 75185853 splice site probably null
R4569:Dph1 UTSW 11 75178895 unclassified probably benign
R4666:Dph1 UTSW 11 75181330 missense probably damaging 0.98
R6033:Dph1 UTSW 11 75191197 start gained probably benign
R6033:Dph1 UTSW 11 75191197 start gained probably benign
R6451:Dph1 UTSW 11 75181317 missense probably damaging 0.99
R7149:Dph1 UTSW 11 75179175 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGCAGGATTCCCAAGGCAG -3'
(R):5'- TGCCAAGTCAAGGAGATCTGG -3'

Sequencing Primer
(F):5'- GGATTCCCAAGGCAGCCAAATC -3'
(R):5'- GAGATCTGGGTCCTGAAACACCTC -3'
Posted On2014-06-30