Incidental Mutation 'R1878:Spag1'
ID211339
Institutional Source Beutler Lab
Gene Symbol Spag1
Ensembl Gene ENSMUSG00000037617
Gene Namesperm associated antigen 1
Synonymstpis, TPR-containing protein involved in spermatogenesis
MMRRC Submission 039899-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R1878 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location36178099-36235621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36181770 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 25 (E25K)
Ref Sequence ENSEMBL: ENSMUSP00000132233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047348] [ENSMUST00000057177] [ENSMUST00000171205] [ENSMUST00000180159] [ENSMUST00000227623]
Predicted Effect probably damaging
Transcript: ENSMUST00000047348
AA Change: E25K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047335
Gene: ENSMUSG00000037617
AA Change: E25K

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057177
SMART Domains Protein: ENSMUSP00000051968
Gene: ENSMUSG00000045996

DomainStartEndE-ValueType
RPOLCX 56 99 6.19e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171205
AA Change: E25K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132233
Gene: ENSMUSG00000037617
AA Change: E25K

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180159
SMART Domains Protein: ENSMUSP00000136975
Gene: ENSMUSG00000045996

DomainStartEndE-ValueType
RPOLCX 15 58 6.19e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000227623
AA Change: E25K

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm agglutinating antibodies from an infertile woman. Furthermore, immunization of female rats with the recombinant human protein reduced fertility. This protein localizes to the plasma membrane of germ cells in the testis and to the post-acrosomal plasma membrane of mature spermatozoa. Recombinant polypeptide binds GTP and exhibits GTPase activity. Thus, this protein may regulate GTP signal transduction pathways involved in spermatogenesis and fertilization. Two transcript variants of this gene encode the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,514,638 probably null Het
Abcb9 A G 5: 124,090,136 V14A probably benign Het
Adcy4 T C 14: 55,769,905 D950G probably damaging Het
Ahctf1 T C 1: 179,775,509 D828G possibly damaging Het
Ak2 T A 4: 129,002,167 V79D probably damaging Het
Arhgap29 T C 3: 122,011,371 Y870H probably damaging Het
Arid4a A G 12: 71,087,589 K1222E probably damaging Het
Armc1 A T 3: 19,157,544 D37E probably damaging Het
Cenpm A T 15: 82,234,415 M166K probably benign Het
Cep97 G T 16: 55,905,226 P766Q probably damaging Het
Col19a1 G T 1: 24,317,395 D672E probably benign Het
Col6a2 T C 10: 76,614,788 D103G probably benign Het
Ddi2 T C 4: 141,684,149 E484G probably benign Het
Dph1 T C 11: 75,184,227 D100G probably damaging Het
Dsp A T 13: 38,164,855 I100F possibly damaging Het
Fam222b T C 11: 78,143,216 probably null Het
Folh1 A T 7: 86,771,742 H126Q probably benign Het
Gapvd1 A T 2: 34,725,200 D428E probably benign Het
Gm11564 A T 11: 99,815,440 C55S unknown Het
Gm14139 T A 2: 150,193,069 C437S probably damaging Het
Gne T C 4: 44,040,434 I577V probably damaging Het
Gpr4 A G 7: 19,223,124 T324A probably damaging Het
Hhipl1 A T 12: 108,320,060 N542I possibly damaging Het
Ice2 T C 9: 69,428,576 probably null Het
Irgm1 C T 11: 48,866,070 V305I probably benign Het
Itgal C A 7: 127,310,671 Q73K probably benign Het
Jcad C A 18: 4,673,857 H540N possibly damaging Het
Jkamp T A 12: 72,094,104 V141D possibly damaging Het
Lrrc9 T C 12: 72,476,164 probably null Het
Mcc T C 18: 44,468,400 R621G possibly damaging Het
Myd88 T A 9: 119,338,620 Q140L probably benign Het
Mylk3 A T 8: 85,355,399 N323K possibly damaging Het
Myrip C T 9: 120,424,655 R265W probably damaging Het
N4bp1 A T 8: 86,861,541 S256R probably damaging Het
Nhsl1 T G 10: 18,524,279 S418A probably damaging Het
Nlrp9b A G 7: 20,028,564 T269A probably benign Het
Nmt1 A G 11: 103,052,251 N144S probably benign Het
Npvf G A 6: 50,654,323 T24I probably benign Het
Obscn T G 11: 58,995,553 Y2347S probably damaging Het
Olfr1202 A G 2: 88,817,461 T97A probably benign Het
Olfr125 T C 17: 37,835,362 V121A probably benign Het
Olfr135 T C 17: 38,208,374 I43T probably benign Het
Olfr170 G T 16: 19,605,751 Q306K probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr624 A C 7: 103,670,182 M283R probably damaging Het
Olfr8 T A 10: 78,955,805 M200K possibly damaging Het
Olfr975 T A 9: 39,950,757 T5S probably benign Het
Osgin2 A T 4: 16,005,493 V131D probably damaging Het
Pcdhac2 A T 18: 37,145,162 K398N possibly damaging Het
Pcnp A T 16: 56,018,487 M143K probably damaging Het
Ppp3ca A G 3: 136,797,878 I71V probably benign Het
Ppp4c G T 7: 126,787,607 R103S probably damaging Het
Prl2c2 T A 13: 13,005,326 M1L probably damaging Het
Recql5 A T 11: 115,895,101 D615E probably benign Het
Robo3 T C 9: 37,422,165 E728G probably damaging Het
Rps27l T A 9: 66,947,629 probably null Het
Scube3 T A 17: 28,152,413 V34E probably benign Het
Sez6l A G 5: 112,475,223 I154T probably damaging Het
Sgsm1 G A 5: 113,263,515 L782F probably damaging Het
Slc35c1 A G 2: 92,459,053 V36A probably benign Het
Snapc4 A G 2: 26,376,153 probably null Het
Sohlh2 C A 3: 55,207,643 R350S probably damaging Het
Sspo G A 6: 48,459,366 A1217T possibly damaging Het
Stil T C 4: 115,041,226 S1018P probably damaging Het
Strn T C 17: 78,677,326 E117G possibly damaging Het
Syt17 A T 7: 118,434,245 M180K probably benign Het
Trem1 T C 17: 48,241,488 S18P possibly damaging Het
Tsta3 A G 15: 75,925,369 S306P probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc80 A C 1: 66,509,402 H611P probably damaging Het
Zfp709 A G 8: 71,890,047 E440G probably damaging Het
Zfp764 C A 7: 127,405,042 A306S probably benign Het
Zfp949 T A 9: 88,569,303 S309T probably damaging Het
Zswim4 T C 8: 84,212,776 N826D possibly damaging Het
Other mutations in Spag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Spag1 APN 15 36195416 nonsense probably null
IGL00465:Spag1 APN 15 36183821 unclassified probably benign
IGL00694:Spag1 APN 15 36227171 missense possibly damaging 0.94
IGL01479:Spag1 APN 15 36233199 splice site probably benign
IGL01830:Spag1 APN 15 36221559 missense probably benign 0.01
IGL02072:Spag1 APN 15 36190512 missense probably damaging 1.00
IGL02232:Spag1 APN 15 36221564 missense probably benign 0.00
IGL02727:Spag1 APN 15 36234818 missense probably damaging 1.00
IGL02810:Spag1 APN 15 36234547 missense probably damaging 1.00
IGL03010:Spag1 APN 15 36233273 missense probably benign 0.15
IGL03069:Spag1 APN 15 36224099 splice site probably benign
IGL03244:Spag1 APN 15 36234383 missense probably benign 0.00
FR4737:Spag1 UTSW 15 36197733 critical splice acceptor site probably benign
R0863:Spag1 UTSW 15 36192047 missense probably damaging 1.00
R1177:Spag1 UTSW 15 36234767 missense probably benign 0.21
R1879:Spag1 UTSW 15 36181770 missense probably damaging 1.00
R2086:Spag1 UTSW 15 36227141 missense probably damaging 0.98
R2093:Spag1 UTSW 15 36224130 missense probably damaging 1.00
R2231:Spag1 UTSW 15 36191167 missense probably benign 0.01
R4030:Spag1 UTSW 15 36234301 missense probably damaging 0.99
R4893:Spag1 UTSW 15 36197846 critical splice donor site probably null
R5047:Spag1 UTSW 15 36195442 missense probably damaging 1.00
R5505:Spag1 UTSW 15 36234626 missense probably damaging 0.99
R5741:Spag1 UTSW 15 36183703 missense possibly damaging 0.79
R5805:Spag1 UTSW 15 36200284 missense probably damaging 1.00
R6221:Spag1 UTSW 15 36197803 missense probably benign 0.30
R6236:Spag1 UTSW 15 36211135 missense probably damaging 1.00
R6556:Spag1 UTSW 15 36195407 missense probably damaging 1.00
R6800:Spag1 UTSW 15 36197749 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTCAGGACTACCTAGATTGAGC -3'
(R):5'- TCAGGGACCTATGTACTGACTTC -3'

Sequencing Primer
(F):5'- catacatatatacatatacatgtgtg -3'
(R):5'- TTGTCTCCCTGAAGGCAA -3'
Posted On2014-06-30