Incidental Mutation 'R1878:Tsta3'
ID211340
Institutional Source Beutler Lab
Gene Symbol Tsta3
Ensembl Gene ENSMUSG00000022570
Gene Nametissue specific transplantation antigen P35B
SynonymsTstap35b, FX, GDP-fucose synthase
MMRRC Submission 039899-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1878 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location75924676-75929832 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75925369 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 306 (S306P)
Ref Sequence ENSEMBL: ENSMUSP00000155711 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023231] [ENSMUST00000053918] [ENSMUST00000229085] [ENSMUST00000229289] [ENSMUST00000229641] [ENSMUST00000229951] [ENSMUST00000230303] [ENSMUST00000230364] [ENSMUST00000230610] [ENSMUST00000230736]
Predicted Effect probably benign
Transcript: ENSMUST00000023231
AA Change: S276P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023231
Gene: ENSMUSG00000022570
AA Change: S276P

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 8 74 1.2e-9 PFAM
Pfam:Epimerase 10 245 1.7e-59 PFAM
Pfam:GDP_Man_Dehyd 37 311 3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000053918
SMART Domains Protein: ENSMUSP00000049605
Gene: ENSMUSG00000022571

DomainStartEndE-ValueType
Pfam:F420_oxidored 10 104 1.2e-17 PFAM
Pfam:P5CR_dimer 166 270 5.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229085
Predicted Effect probably benign
Transcript: ENSMUST00000229289
AA Change: S247P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000229641
AA Change: S276P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229786
Predicted Effect probably benign
Transcript: ENSMUST00000229951
AA Change: S306P

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229997
Predicted Effect probably benign
Transcript: ENSMUST00000230303
Predicted Effect probably benign
Transcript: ENSMUST00000230364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230454
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230485
Predicted Effect probably benign
Transcript: ENSMUST00000230610
Predicted Effect probably benign
Transcript: ENSMUST00000230736
AA Change: S282P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230884
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tissue specific transplantation antigen P35B is a NADP(H)-binding protein. It catalyze the two-step epimerase and the reductase reactions in GDP-D-mannose metabolism, converting GDP-4-keto-6-D-deoxymannose to GDP-L-fucose. GDP-L-fucose is the substrate of several fucosyltransferases involved in the expression of many glycoconjugates, including blood group ABH antigens and developmental adhesion antigens. Mutations in this gene may cause leukocyte adhesion deficiency, type II. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation frequently die in utero, while survivors are smaller than normal, show colon abnormalities, have reduced fertility, and frequently die before weaning. Heterozygotes also show some embryonic loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,514,638 probably null Het
Abcb9 A G 5: 124,090,136 V14A probably benign Het
Adcy4 T C 14: 55,769,905 D950G probably damaging Het
Ahctf1 T C 1: 179,775,509 D828G possibly damaging Het
Ak2 T A 4: 129,002,167 V79D probably damaging Het
Arhgap29 T C 3: 122,011,371 Y870H probably damaging Het
Arid4a A G 12: 71,087,589 K1222E probably damaging Het
Armc1 A T 3: 19,157,544 D37E probably damaging Het
Cenpm A T 15: 82,234,415 M166K probably benign Het
Cep97 G T 16: 55,905,226 P766Q probably damaging Het
Col19a1 G T 1: 24,317,395 D672E probably benign Het
Col6a2 T C 10: 76,614,788 D103G probably benign Het
Ddi2 T C 4: 141,684,149 E484G probably benign Het
Dph1 T C 11: 75,184,227 D100G probably damaging Het
Dsp A T 13: 38,164,855 I100F possibly damaging Het
Fam222b T C 11: 78,143,216 probably null Het
Folh1 A T 7: 86,771,742 H126Q probably benign Het
Gapvd1 A T 2: 34,725,200 D428E probably benign Het
Gm11564 A T 11: 99,815,440 C55S unknown Het
Gm14139 T A 2: 150,193,069 C437S probably damaging Het
Gne T C 4: 44,040,434 I577V probably damaging Het
Gpr4 A G 7: 19,223,124 T324A probably damaging Het
Hhipl1 A T 12: 108,320,060 N542I possibly damaging Het
Ice2 T C 9: 69,428,576 probably null Het
Irgm1 C T 11: 48,866,070 V305I probably benign Het
Itgal C A 7: 127,310,671 Q73K probably benign Het
Jcad C A 18: 4,673,857 H540N possibly damaging Het
Jkamp T A 12: 72,094,104 V141D possibly damaging Het
Lrrc9 T C 12: 72,476,164 probably null Het
Mcc T C 18: 44,468,400 R621G possibly damaging Het
Myd88 T A 9: 119,338,620 Q140L probably benign Het
Mylk3 A T 8: 85,355,399 N323K possibly damaging Het
Myrip C T 9: 120,424,655 R265W probably damaging Het
N4bp1 A T 8: 86,861,541 S256R probably damaging Het
Nhsl1 T G 10: 18,524,279 S418A probably damaging Het
Nlrp9b A G 7: 20,028,564 T269A probably benign Het
Nmt1 A G 11: 103,052,251 N144S probably benign Het
Npvf G A 6: 50,654,323 T24I probably benign Het
Obscn T G 11: 58,995,553 Y2347S probably damaging Het
Olfr1202 A G 2: 88,817,461 T97A probably benign Het
Olfr125 T C 17: 37,835,362 V121A probably benign Het
Olfr135 T C 17: 38,208,374 I43T probably benign Het
Olfr170 G T 16: 19,605,751 Q306K probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr624 A C 7: 103,670,182 M283R probably damaging Het
Olfr8 T A 10: 78,955,805 M200K possibly damaging Het
Olfr975 T A 9: 39,950,757 T5S probably benign Het
Osgin2 A T 4: 16,005,493 V131D probably damaging Het
Pcdhac2 A T 18: 37,145,162 K398N possibly damaging Het
Pcnp A T 16: 56,018,487 M143K probably damaging Het
Ppp3ca A G 3: 136,797,878 I71V probably benign Het
Ppp4c G T 7: 126,787,607 R103S probably damaging Het
Prl2c2 T A 13: 13,005,326 M1L probably damaging Het
Recql5 A T 11: 115,895,101 D615E probably benign Het
Robo3 T C 9: 37,422,165 E728G probably damaging Het
Rps27l T A 9: 66,947,629 probably null Het
Scube3 T A 17: 28,152,413 V34E probably benign Het
Sez6l A G 5: 112,475,223 I154T probably damaging Het
Sgsm1 G A 5: 113,263,515 L782F probably damaging Het
Slc35c1 A G 2: 92,459,053 V36A probably benign Het
Snapc4 A G 2: 26,376,153 probably null Het
Sohlh2 C A 3: 55,207,643 R350S probably damaging Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sspo G A 6: 48,459,366 A1217T possibly damaging Het
Stil T C 4: 115,041,226 S1018P probably damaging Het
Strn T C 17: 78,677,326 E117G possibly damaging Het
Syt17 A T 7: 118,434,245 M180K probably benign Het
Trem1 T C 17: 48,241,488 S18P possibly damaging Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc80 A C 1: 66,509,402 H611P probably damaging Het
Zfp709 A G 8: 71,890,047 E440G probably damaging Het
Zfp764 C A 7: 127,405,042 A306S probably benign Het
Zfp949 T A 9: 88,569,303 S309T probably damaging Het
Zswim4 T C 8: 84,212,776 N826D possibly damaging Het
Other mutations in Tsta3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Tsta3 APN 15 75926185 missense probably damaging 0.99
IGL02674:Tsta3 APN 15 75926389 missense probably damaging 1.00
IGL02830:Tsta3 APN 15 75925588 missense probably benign 0.00
R0189:Tsta3 UTSW 15 75926978 missense probably damaging 1.00
R0671:Tsta3 UTSW 15 75928958 missense possibly damaging 0.61
R1885:Tsta3 UTSW 15 75926989 missense possibly damaging 0.89
R1886:Tsta3 UTSW 15 75926989 missense possibly damaging 0.89
R1912:Tsta3 UTSW 15 75925649 missense possibly damaging 0.81
R2116:Tsta3 UTSW 15 75926142 missense probably damaging 1.00
R2393:Tsta3 UTSW 15 75926351 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGGGAGAAACAGCTGTTG -3'
(R):5'- AATGGGGAAGTCACTGTATCC -3'

Sequencing Primer
(F):5'- GCTGTTGCTGAAGCCAGG -3'
(R):5'- GGAAGTCACTGTATCCTTTGGCTC -3'
Posted On2014-06-30