Incidental Mutation 'R1878:Scube3'
ID211346
Institutional Source Beutler Lab
Gene Symbol Scube3
Ensembl Gene ENSMUSG00000038677
Gene Namesignal peptide, CUB domain, EGF-like 3
Synonyms
MMRRC Submission 039899-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R1878 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28142316-28174852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28152413 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 34 (V34E)
Ref Sequence ENSEMBL: ENSMUSP00000038366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043503]
Predicted Effect probably benign
Transcript: ENSMUST00000043503
AA Change: V34E

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038366
Gene: ENSMUSG00000038677
AA Change: V34E

DomainStartEndE-ValueType
low complexity region 9 15 N/A INTRINSIC
EGF_CA 29 69 5.23e-9 SMART
EGF_CA 70 111 1.2e-8 SMART
EGF_CA 112 152 1.14e-9 SMART
EGF 160 198 6.65e-2 SMART
EGF 200 237 7.95e0 SMART
EGF 239 276 7.76e-3 SMART
EGF_CA 277 317 7.63e-11 SMART
EGF_CA 318 356 7.01e-10 SMART
EGF_CA 357 398 6.8e-8 SMART
Pfam:GCC2_GCC3 642 689 8.6e-15 PFAM
Pfam:GCC2_GCC3 696 743 4.2e-17 PFAM
Pfam:GCC2_GCC3 752 799 5.8e-17 PFAM
CUB 804 916 1.09e-16 SMART
Blast:CUB 942 988 8e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132670
SMART Domains Protein: ENSMUSP00000117490
Gene: ENSMUSG00000038677

DomainStartEndE-ValueType
EGF_like 1 28 1.2e-1 SMART
EGF_CA 29 69 1.14e-9 SMART
EGF 77 115 6.65e-2 SMART
EGF 117 154 7.95e0 SMART
EGF 156 193 7.76e-3 SMART
EGF_CA 194 234 7.63e-11 SMART
EGF_CA 235 273 7.01e-10 SMART
EGF_CA 274 315 6.8e-8 SMART
Pfam:GCC2_GCC3 559 606 1.8e-17 PFAM
Pfam:GCC2_GCC3 615 662 4.2e-17 PFAM
CUB 667 779 1.09e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137147
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal peptide, complement subcomponents C1r/C1s, Uegf, bone morphogenetic protein-1 and epidermal growth factor-like domain containing protein family. Overexpression of this gene in human embryonic kidney cells results in secretion of a glycosylated form of the protein that forms oligomers and tethers to the cell surface. This gene is upregulated in lung cancer tumor tissue compared to healthy tissue and is associated with loss of the epithelial marker E-cadherin and with increased expression of vimentin, a mesenchymal marker. In addition, the protein encoded by this gene is a transforming growth factor beta receptor ligand, and when secreted by cancer cells, it can be cleaved in vitro to release the N-terminal epidermal growth factor-like repeat domain and the C-terminal complement subcomponents C1r/C1s domain. Both the full length protein and C-terminal fragment can bind to the transforming growth factor beta type II receptor to promote the epithelial-mesenchymal transition and tumor angiogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted allele encoding a truncated protein exhibit normal morphology. Mice with a point mutation show skeletal abnormalities, bone metabolism alterations, changes in renal function, behavioral alternations and hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,514,638 probably null Het
Abcb9 A G 5: 124,090,136 V14A probably benign Het
Adcy4 T C 14: 55,769,905 D950G probably damaging Het
Ahctf1 T C 1: 179,775,509 D828G possibly damaging Het
Ak2 T A 4: 129,002,167 V79D probably damaging Het
Arhgap29 T C 3: 122,011,371 Y870H probably damaging Het
Arid4a A G 12: 71,087,589 K1222E probably damaging Het
Armc1 A T 3: 19,157,544 D37E probably damaging Het
Cenpm A T 15: 82,234,415 M166K probably benign Het
Cep97 G T 16: 55,905,226 P766Q probably damaging Het
Col19a1 G T 1: 24,317,395 D672E probably benign Het
Col6a2 T C 10: 76,614,788 D103G probably benign Het
Ddi2 T C 4: 141,684,149 E484G probably benign Het
Dph1 T C 11: 75,184,227 D100G probably damaging Het
Dsp A T 13: 38,164,855 I100F possibly damaging Het
Fam222b T C 11: 78,143,216 probably null Het
Folh1 A T 7: 86,771,742 H126Q probably benign Het
Gapvd1 A T 2: 34,725,200 D428E probably benign Het
Gm11564 A T 11: 99,815,440 C55S unknown Het
Gm14139 T A 2: 150,193,069 C437S probably damaging Het
Gne T C 4: 44,040,434 I577V probably damaging Het
Gpr4 A G 7: 19,223,124 T324A probably damaging Het
Hhipl1 A T 12: 108,320,060 N542I possibly damaging Het
Ice2 T C 9: 69,428,576 probably null Het
Irgm1 C T 11: 48,866,070 V305I probably benign Het
Itgal C A 7: 127,310,671 Q73K probably benign Het
Jcad C A 18: 4,673,857 H540N possibly damaging Het
Jkamp T A 12: 72,094,104 V141D possibly damaging Het
Lrrc9 T C 12: 72,476,164 probably null Het
Mcc T C 18: 44,468,400 R621G possibly damaging Het
Myd88 T A 9: 119,338,620 Q140L probably benign Het
Mylk3 A T 8: 85,355,399 N323K possibly damaging Het
Myrip C T 9: 120,424,655 R265W probably damaging Het
N4bp1 A T 8: 86,861,541 S256R probably damaging Het
Nhsl1 T G 10: 18,524,279 S418A probably damaging Het
Nlrp9b A G 7: 20,028,564 T269A probably benign Het
Nmt1 A G 11: 103,052,251 N144S probably benign Het
Npvf G A 6: 50,654,323 T24I probably benign Het
Obscn T G 11: 58,995,553 Y2347S probably damaging Het
Olfr1202 A G 2: 88,817,461 T97A probably benign Het
Olfr125 T C 17: 37,835,362 V121A probably benign Het
Olfr135 T C 17: 38,208,374 I43T probably benign Het
Olfr170 G T 16: 19,605,751 Q306K probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr624 A C 7: 103,670,182 M283R probably damaging Het
Olfr8 T A 10: 78,955,805 M200K possibly damaging Het
Olfr975 T A 9: 39,950,757 T5S probably benign Het
Osgin2 A T 4: 16,005,493 V131D probably damaging Het
Pcdhac2 A T 18: 37,145,162 K398N possibly damaging Het
Pcnp A T 16: 56,018,487 M143K probably damaging Het
Ppp3ca A G 3: 136,797,878 I71V probably benign Het
Ppp4c G T 7: 126,787,607 R103S probably damaging Het
Prl2c2 T A 13: 13,005,326 M1L probably damaging Het
Recql5 A T 11: 115,895,101 D615E probably benign Het
Robo3 T C 9: 37,422,165 E728G probably damaging Het
Rps27l T A 9: 66,947,629 probably null Het
Sez6l A G 5: 112,475,223 I154T probably damaging Het
Sgsm1 G A 5: 113,263,515 L782F probably damaging Het
Slc35c1 A G 2: 92,459,053 V36A probably benign Het
Snapc4 A G 2: 26,376,153 probably null Het
Sohlh2 C A 3: 55,207,643 R350S probably damaging Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sspo G A 6: 48,459,366 A1217T possibly damaging Het
Stil T C 4: 115,041,226 S1018P probably damaging Het
Strn T C 17: 78,677,326 E117G possibly damaging Het
Syt17 A T 7: 118,434,245 M180K probably benign Het
Trem1 T C 17: 48,241,488 S18P possibly damaging Het
Tsta3 A G 15: 75,925,369 S306P probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc80 A C 1: 66,509,402 H611P probably damaging Het
Zfp709 A G 8: 71,890,047 E440G probably damaging Het
Zfp764 C A 7: 127,405,042 A306S probably benign Het
Zfp949 T A 9: 88,569,303 S309T probably damaging Het
Zswim4 T C 8: 84,212,776 N826D possibly damaging Het
Other mutations in Scube3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Scube3 APN 17 28167684 missense probably damaging 1.00
IGL02189:Scube3 APN 17 28162996 missense probably benign
IGL02416:Scube3 APN 17 28164136 missense probably damaging 1.00
IGL02904:Scube3 APN 17 28167600 missense probably benign 0.01
IGL03153:Scube3 APN 17 28167058 missense possibly damaging 0.54
IGL03309:Scube3 APN 17 28164357 nonsense probably null
dinklage UTSW 17 28162388 missense probably damaging 1.00
R0027:Scube3 UTSW 17 28164357 nonsense probably null
R0084:Scube3 UTSW 17 28162961 missense probably benign 0.12
R0122:Scube3 UTSW 17 28166528 splice site probably benign
R0544:Scube3 UTSW 17 28164153 missense probably damaging 1.00
R1779:Scube3 UTSW 17 28168379 splice site probably benign
R1842:Scube3 UTSW 17 28165089 missense probably damaging 1.00
R1950:Scube3 UTSW 17 28164300 missense possibly damaging 0.66
R2011:Scube3 UTSW 17 28168158 missense probably damaging 0.99
R2164:Scube3 UTSW 17 28166134 missense possibly damaging 0.64
R4356:Scube3 UTSW 17 28164309 missense probably benign 0.01
R4392:Scube3 UTSW 17 28164788 missense probably null
R4528:Scube3 UTSW 17 28162999 missense possibly damaging 0.82
R4709:Scube3 UTSW 17 28167192 splice site probably null
R4809:Scube3 UTSW 17 28165173 missense probably damaging 1.00
R4832:Scube3 UTSW 17 28166015 missense probably damaging 0.98
R4841:Scube3 UTSW 17 28164123 missense probably damaging 1.00
R4842:Scube3 UTSW 17 28164123 missense probably damaging 1.00
R5372:Scube3 UTSW 17 28152482 missense probably damaging 0.99
R5889:Scube3 UTSW 17 28160913 missense possibly damaging 0.84
R5936:Scube3 UTSW 17 28165487 missense probably damaging 1.00
R6523:Scube3 UTSW 17 28162388 missense probably damaging 1.00
R7051:Scube3 UTSW 17 28167599 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGACAGTCTGAATTCCTGAAGTG -3'
(R):5'- CAGTCTCACCTTTGCAGTGC -3'

Sequencing Primer
(F):5'- TGAAGTGTTCAGAGGAAGCAAG -3'
(R):5'- GCAGTGCTTCCCATCCTGG -3'
Posted On2014-06-30