Incidental Mutation 'R1878:Olfr135'
ID211348
Institutional Source Beutler Lab
Gene Symbol Olfr135
Ensembl Gene ENSMUSG00000057801
Gene Nameolfactory receptor 135
SynonymsGA_x6K02T2PSCP-2656648-2657586, MOR256-48
MMRRC Submission 039899-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.044) question?
Stock #R1878 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location38204335-38210915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38208374 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 43 (I43T)
Ref Sequence ENSEMBL: ENSMUSP00000150535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076245] [ENSMUST00000213217]
Predicted Effect probably benign
Transcript: ENSMUST00000076245
AA Change: I43T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000075595
Gene: ENSMUSG00000057801
AA Change: I43T

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.6e-50 PFAM
Pfam:7tm_1 41 290 9.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213217
AA Change: I43T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 G A 17: 45,514,638 probably null Het
Abcb9 A G 5: 124,090,136 V14A probably benign Het
Adcy4 T C 14: 55,769,905 D950G probably damaging Het
Ahctf1 T C 1: 179,775,509 D828G possibly damaging Het
Ak2 T A 4: 129,002,167 V79D probably damaging Het
Arhgap29 T C 3: 122,011,371 Y870H probably damaging Het
Arid4a A G 12: 71,087,589 K1222E probably damaging Het
Armc1 A T 3: 19,157,544 D37E probably damaging Het
Cenpm A T 15: 82,234,415 M166K probably benign Het
Cep97 G T 16: 55,905,226 P766Q probably damaging Het
Col19a1 G T 1: 24,317,395 D672E probably benign Het
Col6a2 T C 10: 76,614,788 D103G probably benign Het
Ddi2 T C 4: 141,684,149 E484G probably benign Het
Dph1 T C 11: 75,184,227 D100G probably damaging Het
Dsp A T 13: 38,164,855 I100F possibly damaging Het
Fam222b T C 11: 78,143,216 probably null Het
Folh1 A T 7: 86,771,742 H126Q probably benign Het
Gapvd1 A T 2: 34,725,200 D428E probably benign Het
Gm11564 A T 11: 99,815,440 C55S unknown Het
Gm14139 T A 2: 150,193,069 C437S probably damaging Het
Gne T C 4: 44,040,434 I577V probably damaging Het
Gpr4 A G 7: 19,223,124 T324A probably damaging Het
Hhipl1 A T 12: 108,320,060 N542I possibly damaging Het
Ice2 T C 9: 69,428,576 probably null Het
Irgm1 C T 11: 48,866,070 V305I probably benign Het
Itgal C A 7: 127,310,671 Q73K probably benign Het
Jcad C A 18: 4,673,857 H540N possibly damaging Het
Jkamp T A 12: 72,094,104 V141D possibly damaging Het
Lrrc9 T C 12: 72,476,164 probably null Het
Mcc T C 18: 44,468,400 R621G possibly damaging Het
Myd88 T A 9: 119,338,620 Q140L probably benign Het
Mylk3 A T 8: 85,355,399 N323K possibly damaging Het
Myrip C T 9: 120,424,655 R265W probably damaging Het
N4bp1 A T 8: 86,861,541 S256R probably damaging Het
Nhsl1 T G 10: 18,524,279 S418A probably damaging Het
Nlrp9b A G 7: 20,028,564 T269A probably benign Het
Nmt1 A G 11: 103,052,251 N144S probably benign Het
Npvf G A 6: 50,654,323 T24I probably benign Het
Obscn T G 11: 58,995,553 Y2347S probably damaging Het
Olfr1202 A G 2: 88,817,461 T97A probably benign Het
Olfr125 T C 17: 37,835,362 V121A probably benign Het
Olfr170 G T 16: 19,605,751 Q306K probably benign Het
Olfr345 G T 2: 36,640,189 R50M possibly damaging Het
Olfr624 A C 7: 103,670,182 M283R probably damaging Het
Olfr8 T A 10: 78,955,805 M200K possibly damaging Het
Olfr975 T A 9: 39,950,757 T5S probably benign Het
Osgin2 A T 4: 16,005,493 V131D probably damaging Het
Pcdhac2 A T 18: 37,145,162 K398N possibly damaging Het
Pcnp A T 16: 56,018,487 M143K probably damaging Het
Ppp3ca A G 3: 136,797,878 I71V probably benign Het
Ppp4c G T 7: 126,787,607 R103S probably damaging Het
Prl2c2 T A 13: 13,005,326 M1L probably damaging Het
Recql5 A T 11: 115,895,101 D615E probably benign Het
Robo3 T C 9: 37,422,165 E728G probably damaging Het
Rps27l T A 9: 66,947,629 probably null Het
Scube3 T A 17: 28,152,413 V34E probably benign Het
Sez6l A G 5: 112,475,223 I154T probably damaging Het
Sgsm1 G A 5: 113,263,515 L782F probably damaging Het
Slc35c1 A G 2: 92,459,053 V36A probably benign Het
Snapc4 A G 2: 26,376,153 probably null Het
Sohlh2 C A 3: 55,207,643 R350S probably damaging Het
Spag1 G A 15: 36,181,770 E25K probably damaging Het
Sspo G A 6: 48,459,366 A1217T possibly damaging Het
Stil T C 4: 115,041,226 S1018P probably damaging Het
Strn T C 17: 78,677,326 E117G possibly damaging Het
Syt17 A T 7: 118,434,245 M180K probably benign Het
Trem1 T C 17: 48,241,488 S18P possibly damaging Het
Tsta3 A G 15: 75,925,369 S306P probably benign Het
Umad1 T A 6: 8,427,181 F145I probably damaging Het
Unc80 A C 1: 66,509,402 H611P probably damaging Het
Zfp709 A G 8: 71,890,047 E440G probably damaging Het
Zfp764 C A 7: 127,405,042 A306S probably benign Het
Zfp949 T A 9: 88,569,303 S309T probably damaging Het
Zswim4 T C 8: 84,212,776 N826D possibly damaging Het
Other mutations in Olfr135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Olfr135 APN 17 38208982 missense probably damaging 0.99
IGL01316:Olfr135 APN 17 38208497 missense probably damaging 0.98
IGL01666:Olfr135 APN 17 38208889 missense probably benign 0.11
IGL02096:Olfr135 APN 17 38209183 makesense probably null
R0255:Olfr135 UTSW 17 38208395 missense probably benign
R0630:Olfr135 UTSW 17 38208413 missense probably damaging 0.97
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1185:Olfr135 UTSW 17 38209183 makesense probably null
R1279:Olfr135 UTSW 17 38208787 missense probably benign 0.01
R1969:Olfr135 UTSW 17 38208464 missense probably damaging 1.00
R2374:Olfr135 UTSW 17 38209067 missense probably damaging 0.97
R3708:Olfr135 UTSW 17 38208283 missense probably benign 0.01
R5025:Olfr135 UTSW 17 38208443 missense probably damaging 1.00
R5093:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5095:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5103:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5104:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5105:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5149:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5150:Olfr135 UTSW 17 38208317 missense possibly damaging 0.92
R5344:Olfr135 UTSW 17 38209104 missense probably damaging 1.00
R6608:Olfr135 UTSW 17 38208479 missense probably damaging 1.00
R7300:Olfr135 UTSW 17 38208697 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGAATGCCAACCCTGGATTC -3'
(R):5'- TGAACTACACACCTCAAGTAGCTG -3'

Sequencing Primer
(F):5'- GAATGCCAACCCTGGATTCTATAG -3'
(R):5'- CACCTCAAGTAGCTGATGGTC -3'
Posted On2014-06-30