Incidental Mutation 'R0123:Phf3'
ID21137
Institutional Source Beutler Lab
Gene Symbol Phf3
Ensembl Gene ENSMUSG00000048874
Gene NamePHD finger protein 3
SynonymsAU020177, 2310061N19Rik
MMRRC Submission 038408-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0123 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location30802339-30873921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30805065 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1604 (D1604E)
Ref Sequence ENSEMBL: ENSMUSP00000139610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088310] [ENSMUST00000186733] [ENSMUST00000191329]
Predicted Effect probably benign
Transcript: ENSMUST00000088310
AA Change: D1604E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000085650
Gene: ENSMUSG00000048874
AA Change: D1604E

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186733
AA Change: D1604E

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000139610
Gene: ENSMUSG00000048874
AA Change: D1604E

DomainStartEndE-ValueType
low complexity region 212 223 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
low complexity region 600 611 N/A INTRINSIC
low complexity region 651 660 N/A INTRINSIC
PHD 697 748 3.82e-10 SMART
low complexity region 847 859 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
TFS2M 908 1008 1.28e-47 SMART
Pfam:SPOC 1188 1294 4.2e-26 PFAM
low complexity region 1367 1373 N/A INTRINSIC
low complexity region 1516 1529 N/A INTRINSIC
low complexity region 1597 1620 N/A INTRINSIC
low complexity region 1796 1811 N/A INTRINSIC
low complexity region 1813 1846 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190190
Predicted Effect probably benign
Transcript: ENSMUST00000191329
SMART Domains Protein: ENSMUSP00000139662
Gene: ENSMUSG00000048874

DomainStartEndE-ValueType
Pfam:SPOC 1 88 1.9e-17 PFAM
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a PHD finger-containing gene family. This gene may function as a transcription factor and may be involved in glioblastomas development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,201 probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Becn1 A G 11: 101,290,498 Y326H probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1g T A 11: 94,409,476 H2156L probably damaging Het
Cd22 A G 7: 30,867,108 probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Cmya5 A G 13: 93,095,904 L892P possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Cts8 T A 13: 61,253,577 M75L probably benign Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dlg5 T C 14: 24,147,206 M1558V probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Ell2 T C 13: 75,762,140 probably benign Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Nrxn1 A T 17: 90,995,487 probably null Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Upk1a A T 7: 30,612,394 I25N possibly damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp982 A T 4: 147,512,636 K150I probably benign Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zswim8 T C 14: 20,716,490 probably benign Het
Other mutations in Phf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Phf3 APN 1 30811847 missense probably damaging 0.99
IGL00704:Phf3 APN 1 30804838 missense probably benign
IGL01147:Phf3 APN 1 30804169 missense probably damaging 1.00
IGL01360:Phf3 APN 1 30808728 missense probably damaging 1.00
IGL01376:Phf3 APN 1 30830485 missense possibly damaging 0.62
IGL01396:Phf3 APN 1 30804305 nonsense probably null
IGL01830:Phf3 APN 1 30814067 nonsense probably null
IGL02108:Phf3 APN 1 30829951 missense probably damaging 1.00
IGL02156:Phf3 APN 1 30808778 missense probably damaging 1.00
IGL02576:Phf3 APN 1 30830036 missense probably benign 0.01
IGL03031:Phf3 APN 1 30804653 missense probably benign 0.00
IGL03334:Phf3 APN 1 30805729 missense probably damaging 0.99
IGL03411:Phf3 APN 1 30804401 missense probably damaging 1.00
FR4976:Phf3 UTSW 1 30805023 utr 3 prime probably benign
PIT4458001:Phf3 UTSW 1 30816541 missense probably damaging 1.00
R0037:Phf3 UTSW 1 30804918 missense probably benign 0.03
R0052:Phf3 UTSW 1 30808767 missense probably damaging 1.00
R0114:Phf3 UTSW 1 30805443 missense possibly damaging 0.87
R0225:Phf3 UTSW 1 30805065 missense probably benign 0.01
R0715:Phf3 UTSW 1 30811838 missense probably damaging 1.00
R0835:Phf3 UTSW 1 30830551 missense probably benign 0.02
R0848:Phf3 UTSW 1 30863172 missense probably damaging 1.00
R1473:Phf3 UTSW 1 30805940 missense probably damaging 1.00
R1522:Phf3 UTSW 1 30805648 missense probably benign 0.05
R1549:Phf3 UTSW 1 30804842 missense probably benign 0.00
R1555:Phf3 UTSW 1 30805877 missense possibly damaging 0.86
R1780:Phf3 UTSW 1 30811942 missense probably damaging 1.00
R1789:Phf3 UTSW 1 30806206 missense probably damaging 1.00
R1875:Phf3 UTSW 1 30830623 missense possibly damaging 0.81
R1912:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R1957:Phf3 UTSW 1 30831520 missense probably damaging 1.00
R2019:Phf3 UTSW 1 30811847 missense probably damaging 0.99
R2259:Phf3 UTSW 1 30804343 missense probably benign 0.20
R2305:Phf3 UTSW 1 30805475 nonsense probably null
R2345:Phf3 UTSW 1 30805351 nonsense probably null
R2424:Phf3 UTSW 1 30806349 missense probably damaging 1.00
R2497:Phf3 UTSW 1 30830014 missense probably damaging 1.00
R2504:Phf3 UTSW 1 30810789 missense probably damaging 1.00
R3522:Phf3 UTSW 1 30805603 missense probably damaging 1.00
R3816:Phf3 UTSW 1 30805753 missense probably damaging 1.00
R4152:Phf3 UTSW 1 30831458 missense probably benign 0.13
R4403:Phf3 UTSW 1 30804409 missense probably damaging 1.00
R4658:Phf3 UTSW 1 30863088 missense probably damaging 1.00
R4663:Phf3 UTSW 1 30821215 missense probably damaging 1.00
R4669:Phf3 UTSW 1 30829946 missense probably damaging 1.00
R4706:Phf3 UTSW 1 30805606 missense probably damaging 1.00
R4757:Phf3 UTSW 1 30820827 missense probably damaging 1.00
R4766:Phf3 UTSW 1 30813939 unclassified probably benign
R4786:Phf3 UTSW 1 30816557 nonsense probably null
R5107:Phf3 UTSW 1 30831485 missense probably benign 0.03
R5155:Phf3 UTSW 1 30824376 missense possibly damaging 0.87
R5310:Phf3 UTSW 1 30803806 missense probably damaging 1.00
R5823:Phf3 UTSW 1 30804683 missense probably damaging 1.00
R5944:Phf3 UTSW 1 30820704 missense probably damaging 1.00
R5979:Phf3 UTSW 1 30805746 missense probably damaging 1.00
R6007:Phf3 UTSW 1 30804345 missense probably damaging 1.00
R6024:Phf3 UTSW 1 30863226 missense probably damaging 1.00
R6072:Phf3 UTSW 1 30830688 missense probably benign 0.08
R6533:Phf3 UTSW 1 30806318 missense probably damaging 1.00
R6649:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6653:Phf3 UTSW 1 30805023 missense possibly damaging 0.75
R6852:Phf3 UTSW 1 30804630 missense probably damaging 0.97
R6855:Phf3 UTSW 1 30820123 missense probably damaging 1.00
R6862:Phf3 UTSW 1 30813982 missense probably damaging 1.00
R6930:Phf3 UTSW 1 30811877 missense probably damaging 1.00
R7135:Phf3 UTSW 1 30831109 missense possibly damaging 0.61
R7323:Phf3 UTSW 1 30813130 missense probably benign 0.01
R7352:Phf3 UTSW 1 30804326 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TGCATCCTTGCTTTCAGAAGCTGTC -3'
(R):5'- AGCAGGCTCAGCCACTTGTAGAAC -3'

Sequencing Primer
(F):5'- TCAGAAGCTGTCTGCTGAC -3'
(R):5'- AGAGACTTCATCGGTAGGTTCATC -3'
Posted On2013-04-11