Incidental Mutation 'R0123:Nlgn1'
ID21150
Institutional Source Beutler Lab
Gene Symbol Nlgn1
Ensembl Gene ENSMUSG00000063887
Gene Nameneuroligin 1
SynonymsNL1, Nlg1, 6330415N05Rik
MMRRC Submission 038408-MU
Accession Numbers

Ncbi RefSeq: NM_138666.3; NM_001163387.1; MGI:2179435

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0123 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location25426215-26332460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25435925 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 546 (C546Y)
Ref Sequence ENSEMBL: ENSMUSP00000142200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075054] [ENSMUST00000108308] [ENSMUST00000191835] [ENSMUST00000193603]
PDB Structure
Crystal structure of a synaptic adhesion complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075054
AA Change: C546Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074565
Gene: ENSMUSG00000063887
AA Change: C546Y

DomainStartEndE-ValueType
Pfam:COesterase 29 626 4.8e-199 PFAM
Pfam:Abhydrolase_3 196 302 2.2e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108308
AA Change: C517Y

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103944
Gene: ENSMUSG00000063887
AA Change: C517Y

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000191835
AA Change: C517Y

PolyPhen 2 Score 0.851 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142086
Gene: ENSMUSG00000063887
AA Change: C517Y

DomainStartEndE-ValueType
Pfam:COesterase 29 597 2.5e-190 PFAM
Pfam:Abhydrolase_3 176 306 4.3e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 787 798 N/A INTRINSIC
low complexity region 800 810 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000193603
AA Change: C546Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142200
Gene: ENSMUSG00000063887
AA Change: C546Y

DomainStartEndE-ValueType
Pfam:COesterase 29 626 1.2e-186 PFAM
Pfam:Abhydrolase_3 196 309 3.7e-8 PFAM
transmembrane domain 697 719 N/A INTRINSIC
low complexity region 720 731 N/A INTRINSIC
low complexity region 796 809 N/A INTRINSIC
low complexity region 816 827 N/A INTRINSIC
low complexity region 829 839 N/A INTRINSIC
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 99% (71/72)
MGI Phenotype Strain: 3687638
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile but display impaired NMDA receptor-mediated synaptic transmission onto CA1 pyramidal cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,201 probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Becn1 A G 11: 101,290,498 Y326H probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1g T A 11: 94,409,476 H2156L probably damaging Het
Cd22 A G 7: 30,867,108 probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Cmya5 A G 13: 93,095,904 L892P possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Cts8 T A 13: 61,253,577 M75L probably benign Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dlg5 T C 14: 24,147,206 M1558V probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Ell2 T C 13: 75,762,140 probably benign Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Nrxn1 A T 17: 90,995,487 probably null Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Upk1a A T 7: 30,612,394 I25N possibly damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp982 A T 4: 147,512,636 K150I probably benign Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zswim8 T C 14: 20,716,490 probably benign Het
Other mutations in Nlgn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Nlgn1 APN 3 25436490 missense probably benign 0.02
IGL00543:Nlgn1 APN 3 25433781 missense probably damaging 1.00
IGL00960:Nlgn1 APN 3 25912697 missense probably damaging 1.00
IGL01533:Nlgn1 APN 3 25436363 missense possibly damaging 0.69
IGL02146:Nlgn1 APN 3 25912682 missense probably damaging 0.96
IGL02616:Nlgn1 APN 3 25434245 missense probably damaging 0.99
IGL03342:Nlgn1 APN 3 26133262 missense probably damaging 1.00
P0018:Nlgn1 UTSW 3 25436577 missense probably damaging 1.00
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0010:Nlgn1 UTSW 3 25435842 splice site probably benign
R0134:Nlgn1 UTSW 3 25435925 missense probably damaging 1.00
R0294:Nlgn1 UTSW 3 26133476 missense probably benign 0.23
R0798:Nlgn1 UTSW 3 25434246 missense probably benign 0.05
R1051:Nlgn1 UTSW 3 25912705 missense probably damaging 0.98
R1116:Nlgn1 UTSW 3 25433874 missense probably benign 0.00
R1289:Nlgn1 UTSW 3 25434236 missense possibly damaging 0.87
R1522:Nlgn1 UTSW 3 25435909 missense probably damaging 1.00
R1550:Nlgn1 UTSW 3 25912644 missense probably damaging 1.00
R1669:Nlgn1 UTSW 3 25436134 missense probably damaging 1.00
R1853:Nlgn1 UTSW 3 26133522 missense possibly damaging 0.80
R1856:Nlgn1 UTSW 3 25440037 nonsense probably null
R1935:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1936:Nlgn1 UTSW 3 26331790 utr 5 prime probably benign
R1952:Nlgn1 UTSW 3 25436300 missense probably damaging 1.00
R1953:Nlgn1 UTSW 3 25436300 missense probably damaging 1.00
R2004:Nlgn1 UTSW 3 25433870 missense probably benign 0.29
R2114:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2116:Nlgn1 UTSW 3 26133265 missense probably damaging 1.00
R2198:Nlgn1 UTSW 3 25433761 missense probably damaging 0.99
R2994:Nlgn1 UTSW 3 25435998 missense probably damaging 1.00
R3056:Nlgn1 UTSW 3 25433696 missense possibly damaging 0.53
R4190:Nlgn1 UTSW 3 25433898 missense probably benign
R4196:Nlgn1 UTSW 3 25434392 missense probably damaging 1.00
R4613:Nlgn1 UTSW 3 25436022 missense probably benign 0.01
R4654:Nlgn1 UTSW 3 26133701 missense possibly damaging 0.51
R4757:Nlgn1 UTSW 3 25436168 missense probably damaging 1.00
R4757:Nlgn1 UTSW 3 25436343 missense possibly damaging 0.63
R4815:Nlgn1 UTSW 3 25436030 missense probably damaging 0.99
R4884:Nlgn1 UTSW 3 25912674 missense probably damaging 1.00
R4966:Nlgn1 UTSW 3 25920237 missense possibly damaging 0.65
R5119:Nlgn1 UTSW 3 25433794 missense probably damaging 0.99
R5842:Nlgn1 UTSW 3 26133743 unclassified probably null
R6218:Nlgn1 UTSW 3 25436093 missense probably damaging 1.00
R6397:Nlgn1 UTSW 3 25433663 missense possibly damaging 0.53
R6500:Nlgn1 UTSW 3 25433930 missense possibly damaging 0.84
R6822:Nlgn1 UTSW 3 26133647 missense probably benign 0.00
R6846:Nlgn1 UTSW 3 25436342 missense probably damaging 0.99
R7047:Nlgn1 UTSW 3 25436035 nonsense probably null
R7147:Nlgn1 UTSW 3 26133360 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ATGGCCCATGCAGCTCAGAATC -3'
(R):5'- CAGACCTTCACTCGAACTTTGGCTC -3'

Sequencing Primer
(F):5'- GCAGGTAACGTAACAACTGTTC -3'
(R):5'- GAACTTTGGCTCACCTACATAC -3'
Posted On2013-04-11