Incidental Mutation 'R0123:Rxfp1'
ID21152
Institutional Source Beutler Lab
Gene Symbol Rxfp1
Ensembl Gene ENSMUSG00000034009
Gene Namerelaxin/insulin-like family peptide receptor 1
SynonymsLgr7, LOC381489
MMRRC Submission 038408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock #R0123 (G1)
Quality Score115
Status Validated (trace)
Chromosome3
Chromosomal Location79641611-79737880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79657476 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 327 (S327P)
Ref Sequence ENSEMBL: ENSMUSP00000077611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078527] [ENSMUST00000182491]
Predicted Effect probably damaging
Transcript: ENSMUST00000078527
AA Change: S327P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077611
Gene: ENSMUSG00000034009
AA Change: S327P

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
LRRNT 101 130 9.51e-1 SMART
LRR 126 148 3.65e1 SMART
LRR 149 172 1.19e1 SMART
LRR_TYP 173 196 4.61e-5 SMART
LRR 197 220 1.86e0 SMART
LRR 221 244 1.86e2 SMART
LRR 246 269 2.03e1 SMART
LRR 270 293 1.76e2 SMART
LRR_TYP 294 317 4.24e-4 SMART
LRR 318 341 1.15e1 SMART
LRR 342 365 3.65e1 SMART
Pfam:7tm_1 422 681 2.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182491
SMART Domains Protein: ENSMUSP00000138578
Gene: ENSMUSG00000034009

DomainStartEndE-ValueType
LDLa 26 64 1.61e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183199
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display reduced male fertility, particularly at younger ages and early generations. Impaired nipple development prevents nursing by females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,201 probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Becn1 A G 11: 101,290,498 Y326H probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1g T A 11: 94,409,476 H2156L probably damaging Het
Cd22 A G 7: 30,867,108 probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Cmya5 A G 13: 93,095,904 L892P possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Cts8 T A 13: 61,253,577 M75L probably benign Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dlg5 T C 14: 24,147,206 M1558V probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Ell2 T C 13: 75,762,140 probably benign Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Nrxn1 A T 17: 90,995,487 probably null Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Upk1a A T 7: 30,612,394 I25N possibly damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp982 A T 4: 147,512,636 K150I probably benign Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zswim8 T C 14: 20,716,490 probably benign Het
Other mutations in Rxfp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Rxfp1 APN 3 79652216 missense possibly damaging 0.81
IGL01962:Rxfp1 APN 3 79686868 missense probably damaging 1.00
IGL01975:Rxfp1 APN 3 79660078 missense possibly damaging 0.95
IGL01998:Rxfp1 APN 3 79660096 missense probably benign 0.01
IGL02049:Rxfp1 APN 3 79650492 missense probably damaging 0.99
IGL02153:Rxfp1 APN 3 79660120 missense probably benign 0.00
IGL02490:Rxfp1 APN 3 79652167 critical splice donor site probably null
IGL02526:Rxfp1 APN 3 79670846 critical splice donor site probably null
IGL02985:Rxfp1 APN 3 79652226 missense possibly damaging 0.65
IGL03252:Rxfp1 APN 3 79667683 missense probably benign 0.29
juggler UTSW 3 79650591 nonsense probably null
R0134:Rxfp1 UTSW 3 79657476 missense probably damaging 1.00
R0230:Rxfp1 UTSW 3 79644975 missense probably damaging 1.00
R0257:Rxfp1 UTSW 3 79682535 missense possibly damaging 0.61
R0265:Rxfp1 UTSW 3 79667654 missense probably benign 0.00
R0362:Rxfp1 UTSW 3 79737793 start codon destroyed probably null 0.99
R0394:Rxfp1 UTSW 3 79652377 missense possibly damaging 0.58
R0422:Rxfp1 UTSW 3 79650731 missense probably benign 0.00
R0547:Rxfp1 UTSW 3 79705569 splice site probably null
R0627:Rxfp1 UTSW 3 79648211 missense probably benign 0.00
R0671:Rxfp1 UTSW 3 79663293 splice site probably null
R1309:Rxfp1 UTSW 3 79663292 splice site probably null
R1756:Rxfp1 UTSW 3 79670881 missense probably benign 0.11
R1803:Rxfp1 UTSW 3 79737769 missense probably benign
R2415:Rxfp1 UTSW 3 79663319 missense probably benign 0.14
R2862:Rxfp1 UTSW 3 79682471 missense possibly damaging 0.80
R4087:Rxfp1 UTSW 3 79644949 missense probably damaging 0.99
R4091:Rxfp1 UTSW 3 79644761 missense probably benign
R4250:Rxfp1 UTSW 3 79652272 missense probably benign 0.41
R4335:Rxfp1 UTSW 3 79686798 critical splice donor site probably null
R4447:Rxfp1 UTSW 3 79652127 intron probably benign
R4607:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4608:Rxfp1 UTSW 3 79686889 missense probably damaging 1.00
R4676:Rxfp1 UTSW 3 79705668 missense probably damaging 1.00
R4768:Rxfp1 UTSW 3 79686868 missense probably damaging 1.00
R4812:Rxfp1 UTSW 3 79650582 missense probably benign 0.00
R4909:Rxfp1 UTSW 3 79644802 missense probably benign
R5059:Rxfp1 UTSW 3 79663312 missense probably benign
R5131:Rxfp1 UTSW 3 79652164 splice site probably null
R5641:Rxfp1 UTSW 3 79686892 missense probably damaging 0.98
R5711:Rxfp1 UTSW 3 79678747 missense probably damaging 1.00
R5757:Rxfp1 UTSW 3 79661320 missense possibly damaging 0.89
R5856:Rxfp1 UTSW 3 79663313 missense possibly damaging 0.76
R6296:Rxfp1 UTSW 3 79667848 missense probably damaging 1.00
R6462:Rxfp1 UTSW 3 79648289 missense probably benign 0.07
R6730:Rxfp1 UTSW 3 79650591 nonsense probably null
R7059:Rxfp1 UTSW 3 79652269 missense probably damaging 1.00
Z1088:Rxfp1 UTSW 3 79705704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACAGAGAGATGTAGAGGCTC -3'
(R):5'- GCATGTTTACCACAGTGTGTGCAG -3'

Sequencing Primer
(F):5'- ATGTCTATAGTCCATCAAGGACTC -3'
(R):5'- CTCTTTCTCCAAACAATTTTTAGG -3'
Posted On2013-04-11