Incidental Mutation 'R1891:Wnk2'
ID211532
Institutional Source Beutler Lab
Gene Symbol Wnk2
Ensembl Gene ENSMUSG00000037989
Gene NameWNK lysine deficient protein kinase 2
SynonymsESTM15, X83337, 1810073P09Rik
MMRRC Submission 039911-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.418) question?
Stock #R1891 (G1)
Quality Score133
Status Not validated
Chromosome13
Chromosomal Location49036303-49148014 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 49052724 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 1865 (E1865*)
Ref Sequence ENSEMBL: ENSMUSP00000125448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035538] [ENSMUST00000049265] [ENSMUST00000091623] [ENSMUST00000110096] [ENSMUST00000110097] [ENSMUST00000159196] [ENSMUST00000159559] [ENSMUST00000160087] [ENSMUST00000162403] [ENSMUST00000162581]
Predicted Effect probably null
Transcript: ENSMUST00000035538
AA Change: E1865*
SMART Domains Protein: ENSMUSP00000047231
Gene: ENSMUSG00000037989
AA Change: E1865*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000049265
AA Change: E1865*
SMART Domains Protein: ENSMUSP00000049327
Gene: ENSMUSG00000037989
AA Change: E1865*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
S_TKc 195 453 3.3e-19 SMART
Pfam:OSR1_C 474 511 5.6e-19 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 9.51e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1703 2.12e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2023 2.12e-5 PROSPERO
low complexity region 2069 2089 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000091623
AA Change: E1865*
SMART Domains Protein: ENSMUSP00000089212
Gene: ENSMUSG00000037989
AA Change: E1865*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 1.6e-41 PFAM
Pfam:Pkinase 195 453 1e-54 PFAM
Pfam:OSR1_C 474 511 4e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.52e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 7.41e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 7.41e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
low complexity region 2191 2202 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110096
AA Change: E1766*
SMART Domains Protein: ENSMUSP00000105723
Gene: ENSMUSG00000037989
AA Change: E1766*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.6e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 1015 1038 N/A INTRINSIC
internal_repeat_1 1064 1087 2.89e-5 PROSPERO
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1219 1255 N/A INTRINSIC
low complexity region 1331 1343 N/A INTRINSIC
low complexity region 1351 1359 N/A INTRINSIC
low complexity region 1366 1391 N/A INTRINSIC
low complexity region 1489 1498 N/A INTRINSIC
low complexity region 1721 1732 N/A INTRINSIC
coiled coil region 1737 1768 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110097
AA Change: E1865*
SMART Domains Protein: ENSMUSP00000105724
Gene: ENSMUSG00000037989
AA Change: E1865*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 1.16e-5 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
internal_repeat_2 1611 1713 5.74e-5 PROSPERO
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
internal_repeat_2 1923 2027 5.74e-5 PROSPERO
low complexity region 2117 2137 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159196
AA Change: E360*
SMART Domains Protein: ENSMUSP00000124598
Gene: ENSMUSG00000037989
AA Change: E360*

DomainStartEndE-ValueType
low complexity region 82 92 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
coiled coil region 331 362 N/A INTRINSIC
low complexity region 612 632 N/A INTRINSIC
low complexity region 686 697 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159559
AA Change: E1853*
SMART Domains Protein: ENSMUSP00000123915
Gene: ENSMUSG00000037989
AA Change: E1853*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.7e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.8e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 971 1002 N/A INTRINSIC
low complexity region 1009 1036 N/A INTRINSIC
low complexity region 1101 1124 N/A INTRINSIC
internal_repeat_1 1150 1173 7.19e-6 PROSPERO
low complexity region 1263 1280 N/A INTRINSIC
low complexity region 1305 1341 N/A INTRINSIC
low complexity region 1417 1429 N/A INTRINSIC
low complexity region 1437 1445 N/A INTRINSIC
low complexity region 1452 1477 N/A INTRINSIC
low complexity region 1575 1585 N/A INTRINSIC
internal_repeat_2 1599 1701 3.66e-5 PROSPERO
low complexity region 1808 1819 N/A INTRINSIC
coiled coil region 1824 1855 N/A INTRINSIC
internal_repeat_2 1911 2015 3.66e-5 PROSPERO
low complexity region 2105 2125 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160087
AA Change: E1006*
SMART Domains Protein: ENSMUSP00000124614
Gene: ENSMUSG00000037989
AA Change: E1006*

DomainStartEndE-ValueType
low complexity region 61 71 N/A INTRINSIC
low complexity region 80 94 N/A INTRINSIC
low complexity region 115 130 N/A INTRINSIC
low complexity region 178 194 N/A INTRINSIC
low complexity region 255 278 N/A INTRINSIC
low complexity region 417 434 N/A INTRINSIC
low complexity region 459 495 N/A INTRINSIC
low complexity region 571 583 N/A INTRINSIC
low complexity region 591 599 N/A INTRINSIC
low complexity region 606 631 N/A INTRINSIC
low complexity region 729 738 N/A INTRINSIC
low complexity region 961 972 N/A INTRINSIC
coiled coil region 977 1008 N/A INTRINSIC
low complexity region 1258 1278 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162403
AA Change: E1755*
SMART Domains Protein: ENSMUSP00000125539
Gene: ENSMUSG00000037989
AA Change: E1755*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.3e-42 PFAM
Pfam:Pkinase 195 453 1.6e-56 PFAM
Pfam:OSR1_C 474 511 5.3e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 736 N/A INTRINSIC
low complexity region 759 791 N/A INTRINSIC
low complexity region 809 819 N/A INTRINSIC
low complexity region 828 842 N/A INTRINSIC
low complexity region 863 878 N/A INTRINSIC
low complexity region 926 942 N/A INTRINSIC
low complexity region 1003 1026 N/A INTRINSIC
internal_repeat_1 1052 1075 1.05e-5 PROSPERO
low complexity region 1165 1182 N/A INTRINSIC
low complexity region 1207 1243 N/A INTRINSIC
low complexity region 1319 1331 N/A INTRINSIC
low complexity region 1339 1347 N/A INTRINSIC
low complexity region 1354 1379 N/A INTRINSIC
low complexity region 1477 1487 N/A INTRINSIC
internal_repeat_2 1501 1593 2.32e-5 PROSPERO
low complexity region 1710 1721 N/A INTRINSIC
coiled coil region 1726 1757 N/A INTRINSIC
internal_repeat_2 1813 1913 2.32e-5 PROSPERO
low complexity region 1959 1979 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162581
AA Change: E1865*
SMART Domains Protein: ENSMUSP00000125448
Gene: ENSMUSG00000037989
AA Change: E1865*

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 171 182 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 451 4.5e-42 PFAM
Pfam:Pkinase 195 453 1.7e-56 PFAM
Pfam:OSR1_C 474 511 5.6e-22 PFAM
low complexity region 582 593 N/A INTRINSIC
low complexity region 626 642 N/A INTRINSIC
low complexity region 678 693 N/A INTRINSIC
low complexity region 707 724 N/A INTRINSIC
low complexity region 771 803 N/A INTRINSIC
low complexity region 821 831 N/A INTRINSIC
low complexity region 840 854 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 938 954 N/A INTRINSIC
low complexity region 983 1014 N/A INTRINSIC
low complexity region 1021 1048 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
internal_repeat_1 1162 1185 6.72e-6 PROSPERO
low complexity region 1275 1292 N/A INTRINSIC
low complexity region 1317 1353 N/A INTRINSIC
low complexity region 1429 1441 N/A INTRINSIC
low complexity region 1449 1457 N/A INTRINSIC
low complexity region 1464 1489 N/A INTRINSIC
low complexity region 1587 1597 N/A INTRINSIC
low complexity region 1820 1831 N/A INTRINSIC
coiled coil region 1836 1867 N/A INTRINSIC
low complexity region 2033 2053 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic serine-threonine kinase that belongs to the protein kinase superfamily. The protein plays an important role in the regulation of electrolyte homeostasis, cell signaling survival, and proliferation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,033 M135K possibly damaging Het
Abca7 T C 10: 80,005,040 I921T possibly damaging Het
Abca8a T C 11: 110,091,607 K3R probably benign Het
Adgrl3 A T 5: 81,512,044 D152V probably damaging Het
Akap6 A T 12: 53,142,175 D2124V possibly damaging Het
Akt1 A G 12: 112,659,575 F88L probably damaging Het
Ankrd24 T C 10: 81,643,508 probably benign Het
Arid4b T A 13: 14,136,236 N141K possibly damaging Het
Cacna1c C A 6: 118,776,519 D219Y probably damaging Het
Ccdc113 A G 8: 95,540,916 K170E probably damaging Het
Ccdc151 G T 9: 21,995,381 probably null Het
Ceacam9 A G 7: 16,723,955 E136G probably damaging Het
Cfap43 A G 19: 47,813,941 L333P probably damaging Het
Chl1 A G 6: 103,714,583 D1062G possibly damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Clpp T A 17: 56,991,307 V91E probably damaging Het
Cndp1 A T 18: 84,619,633 H325Q probably null Het
Cngb3 A G 4: 19,366,446 N169S probably benign Het
Cog6 A C 3: 52,983,180 I613R probably benign Het
Creb3l1 A G 2: 91,987,040 L376P probably damaging Het
Cry2 A T 2: 92,413,640 V396D possibly damaging Het
Cxxc5 A G 18: 35,859,265 M240V possibly damaging Het
Defa28 G A 8: 21,583,785 C68Y probably damaging Het
Dgcr14 C T 16: 17,907,780 W183* probably null Het
Ecd A G 14: 20,338,159 I187T probably damaging Het
Erg28 A G 12: 85,816,188 S117P probably benign Het
Ergic2 A T 6: 148,183,079 C319S probably damaging Het
Evc2 A C 5: 37,392,079 D773A probably damaging Het
Fam151b T A 13: 92,450,170 T252S probably benign Het
Fbxo28 A T 1: 182,317,824 M233K probably benign Het
Fbxw26 T G 9: 109,722,164 D355A probably benign Het
Gm13101 A T 4: 143,966,665 V81E probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Hk2 C T 6: 82,749,283 R94Q probably benign Het
Hps4 G A 5: 112,369,556 probably null Het
Hspg2 T A 4: 137,565,490 D4126E probably damaging Het
Kif13a T C 13: 46,929,219 E48G possibly damaging Het
Krt31 T A 11: 100,047,808 N320Y probably damaging Het
Lca5 T C 9: 83,395,608 Y561C probably damaging Het
Lrrk1 G A 7: 66,279,300 L1195F probably damaging Het
Ly6g6d A C 17: 35,074,293 Y25* probably null Het
Map3k13 T G 16: 21,911,086 M489R probably damaging Het
Mcm6 C T 1: 128,335,810 R658H probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Mitf A G 6: 97,941,276 T94A probably benign Het
Mpo T A 11: 87,801,280 L513* probably null Het
Mst1r T A 9: 107,913,462 N722K probably damaging Het
Mthfd1l T A 10: 4,032,284 L497* probably null Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Naip2 C T 13: 100,154,887 R1181K probably benign Het
Nbas T C 12: 13,390,972 M1101T possibly damaging Het
Olfr10 T C 11: 49,317,857 F104L probably benign Het
Olfr1313 A T 2: 112,072,394 L63Q probably damaging Het
Olfr19 T A 16: 16,673,577 I135F probably damaging Het
Olfr290 T A 7: 84,916,253 V158D possibly damaging Het
Olfr685 A T 7: 105,180,547 Y270* probably null Het
Olfr820 T C 10: 130,017,570 S70P probably damaging Het
Olfr835 T C 9: 19,035,978 L285S probably damaging Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Oxct2b A G 4: 123,117,145 D286G probably benign Het
Pax5 A T 4: 44,691,859 V129E probably damaging Het
Pax7 G A 4: 139,784,626 R215C probably damaging Het
Pcdh7 A T 5: 57,720,875 I591F probably damaging Het
Pcdhb22 T C 18: 37,519,304 V275A probably damaging Het
Pkp3 C T 7: 141,084,056 probably null Het
Plekhb1 A G 7: 100,655,392 L35P probably damaging Het
Pole T A 5: 110,332,542 F1993Y probably damaging Het
Prdx1 T C 4: 116,699,254 *200R probably null Het
Prkdc C A 16: 15,725,436 T1777N probably benign Het
Ptpn14 G A 1: 189,798,653 V106M probably damaging Het
Ptpn23 T C 9: 110,393,800 E63G possibly damaging Het
Qser1 A C 2: 104,790,099 S123A probably benign Het
Rbm11 A G 16: 75,600,787 N202D possibly damaging Het
Robo3 T A 9: 37,428,055 Y212F probably damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Serpinb1c T A 13: 32,884,252 D179V probably benign Het
Skint6 T C 4: 112,846,696 D994G possibly damaging Het
Sorbs1 A G 19: 40,393,460 S46P probably damaging Het
St8sia4 T C 1: 95,591,708 T352A possibly damaging Het
Stab1 C A 14: 31,141,330 R2133L probably benign Het
Stk11ip T C 1: 75,532,416 C730R probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex33 T A 15: 78,378,752 D234V probably damaging Het
Tle4 A T 19: 14,544,786 probably null Het
Tmem200a T A 10: 25,994,072 N100Y probably damaging Het
Tnnt2 A T 1: 135,840,859 probably null Het
Ttn T A 2: 76,875,958 probably benign Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Urgcp T C 11: 5,716,910 E476G probably benign Het
Vmn1r201 G A 13: 22,475,255 R213H probably benign Het
Vmn2r84 C T 10: 130,386,069 V761M possibly damaging Het
Vwde A T 6: 13,187,455 Y678N probably damaging Het
Zc3h3 A C 15: 75,756,931 M838R possibly damaging Het
Zfp959 T A 17: 55,897,604 C211S probably damaging Het
Other mutations in Wnk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Wnk2 APN 13 49068192 missense possibly damaging 0.89
IGL01575:Wnk2 APN 13 49146676 missense probably damaging 1.00
IGL01601:Wnk2 APN 13 49076562 missense probably damaging 1.00
IGL01775:Wnk2 APN 13 49071110 missense probably damaging 1.00
IGL02013:Wnk2 APN 13 49082034 missense possibly damaging 0.46
IGL02016:Wnk2 APN 13 49056905 missense probably damaging 1.00
IGL02167:Wnk2 APN 13 49071125 critical splice acceptor site probably null
IGL02174:Wnk2 APN 13 49057167 missense probably damaging 1.00
IGL02210:Wnk2 APN 13 49090869 missense probably damaging 0.98
IGL02228:Wnk2 APN 13 49056940 missense probably damaging 1.00
IGL02282:Wnk2 APN 13 49068125 missense probably damaging 1.00
IGL02319:Wnk2 APN 13 49061438 missense possibly damaging 0.73
IGL02394:Wnk2 APN 13 49081899 splice site probably null
IGL02624:Wnk2 APN 13 49102802 missense probably damaging 1.00
IGL02743:Wnk2 APN 13 49095444 missense probably damaging 1.00
IGL03012:Wnk2 APN 13 49044389 missense probably damaging 0.99
IGL03166:Wnk2 APN 13 49071044 nonsense probably null
R0034:Wnk2 UTSW 13 49068080 missense possibly damaging 0.64
R0385:Wnk2 UTSW 13 49068128 missense probably damaging 1.00
R0423:Wnk2 UTSW 13 49095418 missense possibly damaging 0.91
R0504:Wnk2 UTSW 13 49085394 missense possibly damaging 0.92
R0504:Wnk2 UTSW 13 49085396 missense probably damaging 1.00
R0653:Wnk2 UTSW 13 49057016 missense possibly damaging 0.85
R1135:Wnk2 UTSW 13 49076558 missense probably damaging 1.00
R1445:Wnk2 UTSW 13 49071110 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1464:Wnk2 UTSW 13 49081975 missense probably damaging 1.00
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1468:Wnk2 UTSW 13 49082095 missense probably damaging 0.99
R1480:Wnk2 UTSW 13 49057232 missense probably damaging 1.00
R1605:Wnk2 UTSW 13 49060894 missense probably damaging 1.00
R1719:Wnk2 UTSW 13 49060726 missense possibly damaging 0.76
R1966:Wnk2 UTSW 13 49039011 missense probably damaging 0.96
R2001:Wnk2 UTSW 13 49078682 missense possibly damaging 0.61
R2310:Wnk2 UTSW 13 49050577 missense probably damaging 0.97
R2356:Wnk2 UTSW 13 49039168 nonsense probably null
R2406:Wnk2 UTSW 13 49061488 missense possibly damaging 0.86
R2519:Wnk2 UTSW 13 49071029 missense probably damaging 0.99
R3962:Wnk2 UTSW 13 49070977 missense probably damaging 1.00
R4160:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4161:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4226:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4227:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4234:Wnk2 UTSW 13 49061128 missense probably benign 0.33
R4304:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4308:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4584:Wnk2 UTSW 13 49090837 missense probably damaging 1.00
R4655:Wnk2 UTSW 13 49056883 missense probably damaging 1.00
R4715:Wnk2 UTSW 13 49147232 start codon destroyed unknown
R4887:Wnk2 UTSW 13 49071002 missense probably damaging 1.00
R4888:Wnk2 UTSW 13 49071002 missense probably damaging 1.00
R4945:Wnk2 UTSW 13 49057246 missense probably damaging 1.00
R5182:Wnk2 UTSW 13 49061161 missense possibly damaging 0.92
R5243:Wnk2 UTSW 13 49072578 missense possibly damaging 0.51
R5370:Wnk2 UTSW 13 49102961 missense probably damaging 1.00
R5771:Wnk2 UTSW 13 49102800 missense probably damaging 1.00
R5877:Wnk2 UTSW 13 49067306 missense probably damaging 0.98
R5900:Wnk2 UTSW 13 49102832 missense probably damaging 1.00
R5905:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R5912:Wnk2 UTSW 13 49060774 missense probably damaging 1.00
R5915:Wnk2 UTSW 13 49078085 missense probably damaging 0.99
R6028:Wnk2 UTSW 13 49076345 missense probably damaging 0.99
R6074:Wnk2 UTSW 13 49051399 missense probably damaging 1.00
R6171:Wnk2 UTSW 13 49060832 missense probably damaging 1.00
R6368:Wnk2 UTSW 13 49061338 missense probably damaging 0.99
R6467:Wnk2 UTSW 13 49146605 missense probably damaging 1.00
R6501:Wnk2 UTSW 13 49146683 missense probably damaging 1.00
R6849:Wnk2 UTSW 13 49067358 missense probably damaging 1.00
R6898:Wnk2 UTSW 13 49071081 missense probably damaging 1.00
R6949:Wnk2 UTSW 13 49101140 missense probably damaging 1.00
X0025:Wnk2 UTSW 13 49060942 missense probably damaging 0.99
X0063:Wnk2 UTSW 13 49038977 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCCTCCTCAGTCCAGGTATG -3'
(R):5'- TGGAAACTTGACCTATGTGCTC -3'

Sequencing Primer
(F):5'- CACAGAAGCAGCAGACCTGTG -3'
(R):5'- ATGTGCTCCCACCTGGCTTAG -3'
Posted On2014-06-30