Incidental Mutation 'R1891:Stab1'
ID211536
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Namestabilin 1
SynonymsMS-1
MMRRC Submission 039911-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1891 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31139013-31168641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31141330 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 2133 (R2133L)
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618] [ENSMUST00000090212] [ENSMUST00000159249] [ENSMUST00000160024] [ENSMUST00000227096] [ENSMUST00000227794]
Predicted Effect probably benign
Transcript: ENSMUST00000036618
AA Change: R2133L

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: R2133L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090212
SMART Domains Protein: ENSMUSP00000087680
Gene: ENSMUSG00000071547

DomainStartEndE-ValueType
Pfam:5_nucleotid 1 367 1.5e-123 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159208
Predicted Effect probably benign
Transcript: ENSMUST00000159249
SMART Domains Protein: ENSMUSP00000125542
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
EGF 110 147 1.26e-2 SMART
EGF 157 191 1.61e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159480
Predicted Effect probably benign
Transcript: ENSMUST00000160024
SMART Domains Protein: ENSMUSP00000125239
Gene: ENSMUSG00000042286

DomainStartEndE-ValueType
Blast:FAS1 1 32 5e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161129
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162763
Predicted Effect probably benign
Transcript: ENSMUST00000226975
Predicted Effect probably benign
Transcript: ENSMUST00000227096
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227690
Predicted Effect probably benign
Transcript: ENSMUST00000227794
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,033 M135K possibly damaging Het
Abca7 T C 10: 80,005,040 I921T possibly damaging Het
Abca8a T C 11: 110,091,607 K3R probably benign Het
Adgrl3 A T 5: 81,512,044 D152V probably damaging Het
Akap6 A T 12: 53,142,175 D2124V possibly damaging Het
Akt1 A G 12: 112,659,575 F88L probably damaging Het
Ankrd24 T C 10: 81,643,508 probably benign Het
Arid4b T A 13: 14,136,236 N141K possibly damaging Het
Cacna1c C A 6: 118,776,519 D219Y probably damaging Het
Ccdc113 A G 8: 95,540,916 K170E probably damaging Het
Ccdc151 G T 9: 21,995,381 probably null Het
Ceacam9 A G 7: 16,723,955 E136G probably damaging Het
Cfap43 A G 19: 47,813,941 L333P probably damaging Het
Chl1 A G 6: 103,714,583 D1062G possibly damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Clpp T A 17: 56,991,307 V91E probably damaging Het
Cndp1 A T 18: 84,619,633 H325Q probably null Het
Cngb3 A G 4: 19,366,446 N169S probably benign Het
Cog6 A C 3: 52,983,180 I613R probably benign Het
Creb3l1 A G 2: 91,987,040 L376P probably damaging Het
Cry2 A T 2: 92,413,640 V396D possibly damaging Het
Cxxc5 A G 18: 35,859,265 M240V possibly damaging Het
Defa28 G A 8: 21,583,785 C68Y probably damaging Het
Dgcr14 C T 16: 17,907,780 W183* probably null Het
Ecd A G 14: 20,338,159 I187T probably damaging Het
Erg28 A G 12: 85,816,188 S117P probably benign Het
Ergic2 A T 6: 148,183,079 C319S probably damaging Het
Evc2 A C 5: 37,392,079 D773A probably damaging Het
Fam151b T A 13: 92,450,170 T252S probably benign Het
Fbxo28 A T 1: 182,317,824 M233K probably benign Het
Fbxw26 T G 9: 109,722,164 D355A probably benign Het
Gm13101 A T 4: 143,966,665 V81E probably damaging Het
Gm4884 G C 7: 41,043,115 E169D possibly damaging Het
Hk2 C T 6: 82,749,283 R94Q probably benign Het
Hps4 G A 5: 112,369,556 probably null Het
Hspg2 T A 4: 137,565,490 D4126E probably damaging Het
Kif13a T C 13: 46,929,219 E48G possibly damaging Het
Krt31 T A 11: 100,047,808 N320Y probably damaging Het
Lca5 T C 9: 83,395,608 Y561C probably damaging Het
Lrrk1 G A 7: 66,279,300 L1195F probably damaging Het
Ly6g6d A C 17: 35,074,293 Y25* probably null Het
Map3k13 T G 16: 21,911,086 M489R probably damaging Het
Mcm6 C T 1: 128,335,810 R658H probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Mitf A G 6: 97,941,276 T94A probably benign Het
Mpo T A 11: 87,801,280 L513* probably null Het
Mst1r T A 9: 107,913,462 N722K probably damaging Het
Mthfd1l T A 10: 4,032,284 L497* probably null Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Naip2 C T 13: 100,154,887 R1181K probably benign Het
Nbas T C 12: 13,390,972 M1101T possibly damaging Het
Olfr10 T C 11: 49,317,857 F104L probably benign Het
Olfr1313 A T 2: 112,072,394 L63Q probably damaging Het
Olfr19 T A 16: 16,673,577 I135F probably damaging Het
Olfr290 T A 7: 84,916,253 V158D possibly damaging Het
Olfr685 A T 7: 105,180,547 Y270* probably null Het
Olfr820 T C 10: 130,017,570 S70P probably damaging Het
Olfr835 T C 9: 19,035,978 L285S probably damaging Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Oxct2b A G 4: 123,117,145 D286G probably benign Het
Pax5 A T 4: 44,691,859 V129E probably damaging Het
Pax7 G A 4: 139,784,626 R215C probably damaging Het
Pcdh7 A T 5: 57,720,875 I591F probably damaging Het
Pcdhb22 T C 18: 37,519,304 V275A probably damaging Het
Pkp3 C T 7: 141,084,056 probably null Het
Plekhb1 A G 7: 100,655,392 L35P probably damaging Het
Pole T A 5: 110,332,542 F1993Y probably damaging Het
Prdx1 T C 4: 116,699,254 *200R probably null Het
Prkdc C A 16: 15,725,436 T1777N probably benign Het
Ptpn14 G A 1: 189,798,653 V106M probably damaging Het
Ptpn23 T C 9: 110,393,800 E63G possibly damaging Het
Qser1 A C 2: 104,790,099 S123A probably benign Het
Rbm11 A G 16: 75,600,787 N202D possibly damaging Het
Robo3 T A 9: 37,428,055 Y212F probably damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Serpinb1c T A 13: 32,884,252 D179V probably benign Het
Skint6 T C 4: 112,846,696 D994G possibly damaging Het
Sorbs1 A G 19: 40,393,460 S46P probably damaging Het
St8sia4 T C 1: 95,591,708 T352A possibly damaging Het
Stk11ip T C 1: 75,532,416 C730R probably benign Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tex33 T A 15: 78,378,752 D234V probably damaging Het
Tle4 A T 19: 14,544,786 probably null Het
Tmem200a T A 10: 25,994,072 N100Y probably damaging Het
Tnnt2 A T 1: 135,840,859 probably null Het
Ttn T A 2: 76,875,958 probably benign Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Urgcp T C 11: 5,716,910 E476G probably benign Het
Vmn1r201 G A 13: 22,475,255 R213H probably benign Het
Vmn2r84 C T 10: 130,386,069 V761M possibly damaging Het
Vwde A T 6: 13,187,455 Y678N probably damaging Het
Wnk2 C A 13: 49,052,724 E1865* probably null Het
Zc3h3 A C 15: 75,756,931 M838R possibly damaging Het
Zfp959 T A 17: 55,897,604 C211S probably damaging Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31161357 missense probably benign 0.01
IGL00323:Stab1 APN 14 31139306 missense probably benign 0.04
IGL00515:Stab1 APN 14 31159729 missense probably benign 0.20
IGL00844:Stab1 APN 14 31147066 missense probably damaging 1.00
IGL01374:Stab1 APN 14 31147075 missense probably damaging 1.00
IGL01384:Stab1 APN 14 31150408 missense probably benign
IGL01431:Stab1 APN 14 31148995 missense probably benign 0.06
IGL01787:Stab1 APN 14 31139808 missense probably damaging 1.00
IGL02128:Stab1 APN 14 31150441 missense probably damaging 1.00
IGL02138:Stab1 APN 14 31143513 critical splice donor site probably null
IGL02256:Stab1 APN 14 31141592 missense probably damaging 1.00
IGL02340:Stab1 APN 14 31140410 missense probably damaging 0.96
IGL02507:Stab1 APN 14 31139210 unclassified probably benign
IGL02695:Stab1 APN 14 31159271 missense probably damaging 1.00
IGL02755:Stab1 APN 14 31139638 missense probably benign 0.01
IGL02870:Stab1 APN 14 31139397 missense probably benign 0.00
IGL02884:Stab1 APN 14 31150143 splice site probably null
IGL03035:Stab1 APN 14 31147769 missense probably benign 0.00
IGL03267:Stab1 APN 14 31142729 missense probably damaging 1.00
IGL03286:Stab1 APN 14 31159326 splice site probably benign
IGL03366:Stab1 APN 14 31150263 missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31154407 missense probably benign 0.42
IGL02835:Stab1 UTSW 14 31146024 critical splice donor site probably null
K7371:Stab1 UTSW 14 31150249 missense probably damaging 1.00
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0363:Stab1 UTSW 14 31159008 splice site probably benign
R0387:Stab1 UTSW 14 31148101 missense probably benign 0.00
R0391:Stab1 UTSW 14 31143418 missense probably benign 0.21
R0513:Stab1 UTSW 14 31148945 missense probably benign 0.08
R0546:Stab1 UTSW 14 31139550 missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31152600 missense probably benign 0.16
R0906:Stab1 UTSW 14 31145249 missense probably benign 0.19
R0963:Stab1 UTSW 14 31147274 missense probably damaging 0.97
R1219:Stab1 UTSW 14 31140621 unclassified probably null
R1234:Stab1 UTSW 14 31150236 missense probably damaging 1.00
R1260:Stab1 UTSW 14 31151889 missense probably damaging 1.00
R1400:Stab1 UTSW 14 31139830 missense possibly damaging 0.92
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1440:Stab1 UTSW 14 31151690 nonsense probably null
R1472:Stab1 UTSW 14 31141586 missense probably benign 0.01
R1474:Stab1 UTSW 14 31149861 missense probably benign 0.45
R1475:Stab1 UTSW 14 31163828 missense probably benign
R1509:Stab1 UTSW 14 31151584 splice site probably benign
R1551:Stab1 UTSW 14 31160499 missense probably benign 0.00
R1572:Stab1 UTSW 14 31150823 missense probably damaging 1.00
R1633:Stab1 UTSW 14 31150380 intron probably null
R1719:Stab1 UTSW 14 31146028 nonsense probably null
R1733:Stab1 UTSW 14 31145303 missense probably damaging 1.00
R1763:Stab1 UTSW 14 31168416 missense probably benign 0.04
R1808:Stab1 UTSW 14 31141144 missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31157465 missense probably benign 0.03
R1853:Stab1 UTSW 14 31140463 missense probably damaging 1.00
R1984:Stab1 UTSW 14 31150648 missense probably benign 0.20
R1998:Stab1 UTSW 14 31162153 nonsense probably null
R2165:Stab1 UTSW 14 31168435 missense probably benign 0.20
R2191:Stab1 UTSW 14 31142800 missense probably benign 0.03
R2191:Stab1 UTSW 14 31159270 missense probably damaging 1.00
R2233:Stab1 UTSW 14 31161880 missense probably benign 0.08
R2303:Stab1 UTSW 14 31146070 missense probably damaging 1.00
R2496:Stab1 UTSW 14 31161463 missense probably damaging 1.00
R2504:Stab1 UTSW 14 31163040 critical splice donor site probably null
R2519:Stab1 UTSW 14 31154872 missense probably damaging 1.00
R2926:Stab1 UTSW 14 31161799 missense probably damaging 1.00
R4025:Stab1 UTSW 14 31154952 missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31168479 missense probably damaging 0.98
R4258:Stab1 UTSW 14 31154672 missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31157445 missense probably benign 0.01
R4644:Stab1 UTSW 14 31140487 unclassified probably benign
R4660:Stab1 UTSW 14 31154915 missense possibly damaging 0.91
R4801:Stab1 UTSW 14 31141371 nonsense probably null
R4802:Stab1 UTSW 14 31141371 nonsense probably null
R4870:Stab1 UTSW 14 31142043 missense probably benign 0.13
R4872:Stab1 UTSW 14 31140393 missense probably damaging 1.00
R4881:Stab1 UTSW 14 31143672 missense probably benign 0.32
R4941:Stab1 UTSW 14 31151571 missense probably benign 0.00
R5061:Stab1 UTSW 14 31163099 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31143624 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5087:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5092:Stab1 UTSW 14 31145855 missense probably benign 0.01
R5102:Stab1 UTSW 14 31148017 critical splice donor site probably null
R5107:Stab1 UTSW 14 31163795 splice site probably null
R5195:Stab1 UTSW 14 31140521 unclassified probably benign
R5217:Stab1 UTSW 14 31159519 missense probably benign 0.25
R5285:Stab1 UTSW 14 31143476 unclassified probably benign
R5327:Stab1 UTSW 14 31161836 nonsense probably null
R5647:Stab1 UTSW 14 31157440 nonsense probably null
R5696:Stab1 UTSW 14 31160221 missense probably benign
R5996:Stab1 UTSW 14 31139551 missense probably benign 0.39
R6016:Stab1 UTSW 14 31158993 missense probably damaging 1.00
R6017:Stab1 UTSW 14 31141544 missense probably benign 0.00
R6174:Stab1 UTSW 14 31162519 nonsense probably null
R6366:Stab1 UTSW 14 31141438 missense probably benign 0.10
R6754:Stab1 UTSW 14 31141081 missense probably benign
R6788:Stab1 UTSW 14 31139160 missense probably damaging 1.00
R6898:Stab1 UTSW 14 31158963 missense probably benign 0.00
R7124:Stab1 UTSW 14 31160867 missense possibly damaging 0.94
R7145:Stab1 UTSW 14 31145073 critical splice donor site probably null
R7153:Stab1 UTSW 14 31160584 missense probably benign 0.16
X0026:Stab1 UTSW 14 31162191 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCTAGACACTGCAGCCCATC -3'
(R):5'- TGACTTGCAGGTAGGATGC -3'

Sequencing Primer
(F):5'- TACGTGGCATTCACAGCG -3'
(R):5'- AGGTAGGATGCCCTGGATC -3'
Posted On2014-06-30