Incidental Mutation 'R0123:Macf1'
ID 21154
Institutional Source Beutler Lab
Gene Symbol Macf1
Ensembl Gene ENSMUSG00000028649
Gene Name microtubule-actin crosslinking factor 1
Synonyms trabeculin alpha, Aclp7, Acf7
MMRRC Submission 038408-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0123 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 4
Chromosomal Location 123243426-123581331 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 123326636 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 2835 (M2835V)
Ref Sequence ENSEMBL: ENSMUSP00000114568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082108] [ENSMUST00000084301] [ENSMUST00000097897] [ENSMUST00000106213] [ENSMUST00000106220] [ENSMUST00000106224] [ENSMUST00000151346] [ENSMUST00000134458]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000082108
AA Change: M2929V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000080755
Gene: ENSMUSG00000028649
AA Change: M2929V

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
SPEC 1550 1658 3.94e-3 SMART
SPEC 1818 1928 4.03e-9 SMART
SPEC 1935 2041 1.75e-9 SMART
SPEC 2048 2150 5.57e-3 SMART
SPEC 2157 2256 4.56e0 SMART
SPEC 2263 2394 3.46e-1 SMART
SPEC 2401 2506 1.29e-7 SMART
SPEC 2513 2617 1.19e-2 SMART
SPEC 2624 2727 2.7e-1 SMART
SPEC 2734 2837 4.99e-14 SMART
SPEC 2844 2944 1.9e-5 SMART
SPEC 2951 3057 2.83e0 SMART
SPEC 3060 3162 2.14e-4 SMART
SPEC 3169 3273 3.01e-8 SMART
SPEC 3280 3382 4.48e-16 SMART
SPEC 3389 3491 1.26e-10 SMART
SPEC 3498 3600 2.26e-3 SMART
SPEC 3607 3709 4.29e-4 SMART
SPEC 3716 3817 9.99e-14 SMART
SPEC 3824 3930 5.79e-2 SMART
SPEC 3937 4039 6.59e-14 SMART
SPEC 4046 4149 3.7e-17 SMART
SPEC 4156 4258 1.16e-23 SMART
SPEC 4265 4368 3.58e-15 SMART
SPEC 4375 4477 2.61e-17 SMART
SPEC 4484 4587 9.38e-19 SMART
SPEC 4594 4695 2.29e-22 SMART
SPEC 4702 4804 4.99e-14 SMART
SPEC 4811 4941 1.45e-10 SMART
EFh 4979 5007 5.08e-3 SMART
EFh 5015 5043 1.17e-2 SMART
GAS2 5054 5132 8.5e-54 SMART
low complexity region 5154 5199 N/A INTRINSIC
low complexity region 5248 5273 N/A INTRINSIC
low complexity region 5290 5302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084301
AA Change: M4952V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081324
Gene: ENSMUSG00000028649
AA Change: M4952V

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 2.8e-30 SMART
CH 196 293 3.6e-26 SMART
SPEC 317 420 2.6e-2 SMART
SPEC 583 680 2.7e-11 SMART
SPEC 683 783 3.6e-7 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 1.5e-2 SMART
SPEC 1425 1533 6.9e-10 SMART
PLEC 1530 1576 5.3e-6 SMART
PLEC 1577 1614 1.2e-2 SMART
PLEC 1616 1653 8.7e-2 SMART
PLEC 1654 1691 8.3e-2 SMART
PLEC 1695 1729 1.3e-1 SMART
PLEC 1731 1767 1.4e-4 SMART
PLEC 1768 1805 2e-12 SMART
PLEC 1808 1843 5.2e-4 SMART
PLEC 1844 1881 4e-2 SMART
PLEC 1884 1919 1.9e0 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 4.5e-6 SMART
PLEC 2347 2388 1.7e-7 SMART
PLEC 2389 2426 1.2e-5 SMART
PLEC 2447 2484 6.3e-3 SMART
PLEC 2485 2522 2.1e-4 SMART
PLEC 2523 2561 1.5e-1 SMART
PLEC 2586 2633 3.1e-1 SMART
PLEC 2671 2708 6.5e-10 SMART
PLEC 2709 2746 2.3e-3 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3683 7.1e-3 SMART
SPEC 3841 3951 2.6e-11 SMART
SPEC 3958 4064 1.1e-11 SMART
SPEC 4071 4173 3.6e-5 SMART
SPEC 4180 4279 2.9e-2 SMART
SPEC 4286 4417 2.2e-3 SMART
SPEC 4424 4529 8.2e-10 SMART
SPEC 4536 4640 7.4e-5 SMART
SPEC 4647 4750 1.7e-3 SMART
SPEC 4757 4860 3.2e-16 SMART
SPEC 4867 4967 1.2e-7 SMART
SPEC 4974 5080 1.8e-2 SMART
SPEC 5083 5185 1.3e-6 SMART
SPEC 5192 5296 2e-10 SMART
SPEC 5303 5405 2.8e-18 SMART
SPEC 5412 5514 7.7e-13 SMART
SPEC 5521 5623 1.5e-5 SMART
SPEC 5630 5732 2.7e-6 SMART
SPEC 5739 5840 6.1e-16 SMART
SPEC 5847 5953 3.6e-4 SMART
SPEC 5960 6062 4.1e-16 SMART
SPEC 6069 6172 2.4e-19 SMART
SPEC 6179 6281 7.6e-26 SMART
SPEC 6288 6391 2.2e-17 SMART
SPEC 6398 6500 1.6e-19 SMART
SPEC 6507 6610 5.7e-21 SMART
SPEC 6617 6718 1.5e-24 SMART
SPEC 6725 6827 3.2e-16 SMART
SPEC 6834 6964 9.4e-13 SMART
EFh 7002 7030 2.4e-5 SMART
EFh 7038 7066 5.8e-5 SMART
GAS2 7077 7155 5.5e-56 SMART
low complexity region 7177 7222 N/A INTRINSIC
low complexity region 7271 7296 N/A INTRINSIC
low complexity region 7313 7325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097897
AA Change: M4956V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095507
Gene: ENSMUSG00000028649
AA Change: M4956V

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 4e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4644 1.19e-2 SMART
SPEC 4651 4754 2.7e-1 SMART
SPEC 4761 4864 4.99e-14 SMART
SPEC 4871 4971 1.9e-5 SMART
SPEC 4978 5084 2.83e0 SMART
SPEC 5087 5189 2.14e-4 SMART
SPEC 5196 5300 3.01e-8 SMART
SPEC 5307 5409 4.48e-16 SMART
SPEC 5416 5518 1.26e-10 SMART
SPEC 5525 5627 2.26e-3 SMART
SPEC 5634 5736 4.29e-4 SMART
SPEC 5743 5844 9.99e-14 SMART
SPEC 5851 5957 5.79e-2 SMART
SPEC 5964 6066 6.59e-14 SMART
SPEC 6073 6176 3.7e-17 SMART
SPEC 6183 6285 1.16e-23 SMART
SPEC 6292 6395 3.58e-15 SMART
SPEC 6402 6504 2.61e-17 SMART
SPEC 6511 6614 9.38e-19 SMART
SPEC 6621 6722 2.29e-22 SMART
SPEC 6729 6831 4.99e-14 SMART
SPEC 6838 6968 1.45e-10 SMART
EFh 7006 7034 5.08e-3 SMART
EFh 7042 7070 1.17e-2 SMART
GAS2 7081 7159 8.5e-54 SMART
low complexity region 7181 7226 N/A INTRINSIC
low complexity region 7275 7300 N/A INTRINSIC
low complexity region 7317 7329 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106213
AA Change: M3391V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101819
Gene: ENSMUSG00000028649
AA Change: M3391V

DomainStartEndE-ValueType
PLEC 12 49 1.9e0 SMART
PLEC 51 88 1.38e1 SMART
PLEC 89 126 1.3e1 SMART
PLEC 130 164 2.1e1 SMART
PLEC 166 202 2.23e-2 SMART
PLEC 203 240 3.32e-10 SMART
PLEC 243 278 8.32e-2 SMART
PLEC 279 316 6.42e0 SMART
PLEC 319 354 3e2 SMART
low complexity region 421 432 N/A INTRINSIC
low complexity region 654 663 N/A INTRINSIC
PLEC 710 747 6.97e-4 SMART
PLEC 782 823 2.68e-5 SMART
PLEC 824 861 1.84e-3 SMART
PLEC 882 919 1.01e0 SMART
PLEC 920 957 3.38e-2 SMART
PLEC 958 996 2.39e1 SMART
PLEC 1021 1068 4.99e1 SMART
PLEC 1106 1143 1.05e-7 SMART
PLEC 1144 1181 3.57e-1 SMART
low complexity region 1375 1385 N/A INTRINSIC
coiled coil region 1790 1823 N/A INTRINSIC
low complexity region 1854 1864 N/A INTRINSIC
low complexity region 1990 2011 N/A INTRINSIC
SPEC 2012 2120 3.94e-3 SMART
SPEC 2280 2390 4.03e-9 SMART
SPEC 2397 2503 1.75e-9 SMART
SPEC 2510 2612 5.57e-3 SMART
SPEC 2619 2718 4.56e0 SMART
SPEC 2725 2856 3.46e-1 SMART
SPEC 2863 2968 1.29e-7 SMART
SPEC 2975 3079 1.19e-2 SMART
SPEC 3086 3189 2.7e-1 SMART
SPEC 3196 3299 4.99e-14 SMART
SPEC 3306 3406 1.9e-5 SMART
SPEC 3413 3519 2.83e0 SMART
SPEC 3522 3624 2.14e-4 SMART
SPEC 3631 3735 3.01e-8 SMART
SPEC 3742 3844 4.48e-16 SMART
SPEC 3851 3953 4.15e-11 SMART
SPEC 3960 4062 7.07e-5 SMART
SPEC 4069 4171 2.26e-3 SMART
SPEC 4178 4280 4.29e-4 SMART
SPEC 4287 4388 9.99e-14 SMART
SPEC 4395 4501 5.79e-2 SMART
SPEC 4508 4610 6.59e-14 SMART
SPEC 4617 4720 3.7e-17 SMART
SPEC 4727 4829 1.16e-23 SMART
SPEC 4836 4939 3.58e-15 SMART
SPEC 4946 5048 2.61e-17 SMART
SPEC 5055 5158 9.38e-19 SMART
SPEC 5165 5266 2.29e-22 SMART
SPEC 5273 5375 4.99e-14 SMART
SPEC 5382 5512 1.45e-10 SMART
EFh 5546 5574 5.08e-3 SMART
EFh 5582 5610 1.17e-2 SMART
GAS2 5621 5699 8.5e-54 SMART
low complexity region 5721 5766 N/A INTRINSIC
low complexity region 5815 5840 N/A INTRINSIC
low complexity region 5857 5869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106220
AA Change: M3079V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101827
Gene: ENSMUSG00000028649
AA Change: M3079V

DomainStartEndE-ValueType
CH 347 444 7.49e-24 SMART
SPEC 468 571 4.11e0 SMART
SPEC 734 831 4.32e-9 SMART
SPEC 834 934 5.75e-5 SMART
Blast:SPEC 941 1106 5e-82 BLAST
coiled coil region 1197 1218 N/A INTRINSIC
SPEC 1429 1558 2.35e0 SMART
SPEC 1576 1684 1.12e-7 SMART
SPEC 1701 1809 1.85e-1 SMART
SPEC 1968 2078 4.03e-9 SMART
SPEC 2085 2191 1.75e-9 SMART
SPEC 2198 2300 5.57e-3 SMART
SPEC 2307 2406 4.56e0 SMART
SPEC 2413 2544 3.46e-1 SMART
SPEC 2551 2656 1.29e-7 SMART
SPEC 2663 2767 1.19e-2 SMART
SPEC 2774 2877 2.7e-1 SMART
SPEC 2884 2987 4.99e-14 SMART
SPEC 2994 3094 1.9e-5 SMART
SPEC 3101 3207 2.83e0 SMART
SPEC 3210 3312 2.14e-4 SMART
SPEC 3319 3423 3.01e-8 SMART
SPEC 3430 3532 4.48e-16 SMART
SPEC 3539 3641 1.26e-10 SMART
SPEC 3648 3750 2.26e-3 SMART
SPEC 3757 3859 4.29e-4 SMART
SPEC 3866 3967 9.99e-14 SMART
SPEC 3974 4080 5.79e-2 SMART
SPEC 4087 4189 6.59e-14 SMART
SPEC 4196 4299 3.7e-17 SMART
SPEC 4306 4408 1.16e-23 SMART
SPEC 4415 4518 3.58e-15 SMART
SPEC 4525 4627 2.61e-17 SMART
SPEC 4634 4737 9.38e-19 SMART
SPEC 4744 4845 2.29e-22 SMART
SPEC 4852 4954 4.99e-14 SMART
SPEC 4961 5091 1.45e-10 SMART
EFh 5129 5157 5.08e-3 SMART
EFh 5165 5193 1.17e-2 SMART
GAS2 5204 5282 1.59e-53 SMART
low complexity region 5304 5349 N/A INTRINSIC
low complexity region 5398 5423 N/A INTRINSIC
low complexity region 5440 5452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106224
AA Change: M4954V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101831
Gene: ENSMUSG00000028649
AA Change: M4954V

DomainStartEndE-ValueType
low complexity region 6 35 N/A INTRINSIC
low complexity region 65 79 N/A INTRINSIC
CH 80 179 5.63e-28 SMART
CH 196 293 7.49e-24 SMART
SPEC 317 420 4.11e0 SMART
SPEC 583 680 4.32e-9 SMART
SPEC 683 783 5.75e-5 SMART
Blast:SPEC 790 955 5e-82 BLAST
coiled coil region 1046 1067 N/A INTRINSIC
SPEC 1278 1407 2.35e0 SMART
SPEC 1425 1533 1.12e-7 SMART
PLEC 1530 1576 8.58e-4 SMART
PLEC 1577 1614 1.9e0 SMART
PLEC 1616 1653 1.38e1 SMART
PLEC 1654 1691 1.3e1 SMART
PLEC 1695 1729 2.1e1 SMART
PLEC 1731 1767 2.23e-2 SMART
PLEC 1768 1805 3.32e-10 SMART
PLEC 1808 1843 8.32e-2 SMART
PLEC 1844 1881 6.42e0 SMART
PLEC 1884 1919 3e2 SMART
low complexity region 1986 1997 N/A INTRINSIC
low complexity region 2219 2228 N/A INTRINSIC
PLEC 2275 2312 6.97e-4 SMART
PLEC 2347 2388 2.68e-5 SMART
PLEC 2389 2426 1.84e-3 SMART
PLEC 2447 2484 1.01e0 SMART
PLEC 2485 2522 3.38e-2 SMART
PLEC 2523 2561 2.39e1 SMART
PLEC 2586 2633 4.99e1 SMART
PLEC 2671 2708 1.05e-7 SMART
PLEC 2709 2746 3.57e-1 SMART
low complexity region 2940 2950 N/A INTRINSIC
coiled coil region 3355 3388 N/A INTRINSIC
low complexity region 3419 3429 N/A INTRINSIC
low complexity region 3555 3576 N/A INTRINSIC
SPEC 3577 3685 3.94e-3 SMART
SPEC 3845 3955 4.03e-9 SMART
SPEC 3962 4068 1.75e-9 SMART
SPEC 4075 4177 5.57e-3 SMART
SPEC 4184 4283 4.56e0 SMART
SPEC 4290 4421 3.46e-1 SMART
SPEC 4428 4533 1.29e-7 SMART
SPEC 4540 4642 9.34e-2 SMART
SPEC 4649 4752 2.7e-1 SMART
SPEC 4759 4862 4.99e-14 SMART
SPEC 4869 4969 1.9e-5 SMART
SPEC 4976 5082 2.83e0 SMART
SPEC 5085 5187 2.14e-4 SMART
SPEC 5194 5298 3.01e-8 SMART
SPEC 5305 5407 4.48e-16 SMART
SPEC 5414 5516 1.26e-10 SMART
SPEC 5523 5625 2.26e-3 SMART
SPEC 5632 5734 4.29e-4 SMART
SPEC 5741 5842 9.99e-14 SMART
SPEC 5849 5955 5.79e-2 SMART
SPEC 5962 6064 6.59e-14 SMART
SPEC 6071 6174 3.7e-17 SMART
SPEC 6181 6283 1.16e-23 SMART
SPEC 6290 6393 3.58e-15 SMART
SPEC 6400 6502 2.61e-17 SMART
SPEC 6509 6612 9.38e-19 SMART
SPEC 6619 6720 2.29e-22 SMART
SPEC 6727 6829 4.99e-14 SMART
SPEC 6836 6966 1.45e-10 SMART
EFh 7004 7032 5.08e-3 SMART
EFh 7040 7068 1.17e-2 SMART
GAS2 7079 7157 8.5e-54 SMART
low complexity region 7179 7224 N/A INTRINSIC
low complexity region 7273 7298 N/A INTRINSIC
low complexity region 7315 7327 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121747
Predicted Effect possibly damaging
Transcript: ENSMUST00000151346
AA Change: M2835V

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114568
Gene: ENSMUSG00000028649
AA Change: M2835V

DomainStartEndE-ValueType
CH 4 85 4.88e-14 SMART
CH 102 199 7.49e-24 SMART
SPEC 223 326 4.11e0 SMART
SPEC 489 586 4.32e-9 SMART
SPEC 589 689 5.75e-5 SMART
Blast:SPEC 696 861 3e-82 BLAST
coiled coil region 952 973 N/A INTRINSIC
SPEC 1184 1313 2.35e0 SMART
SPEC 1331 1439 1.12e-7 SMART
SPEC 1456 1564 3.94e-3 SMART
SPEC 1724 1834 4.03e-9 SMART
SPEC 1841 1947 1.75e-9 SMART
SPEC 1954 2056 5.57e-3 SMART
SPEC 2063 2162 4.56e0 SMART
SPEC 2169 2300 3.46e-1 SMART
SPEC 2307 2412 1.29e-7 SMART
SPEC 2419 2523 1.19e-2 SMART
SPEC 2530 2633 2.7e-1 SMART
SPEC 2640 2743 4.99e-14 SMART
SPEC 2750 2850 1.9e-5 SMART
SPEC 2857 2963 2.83e0 SMART
SPEC 2966 3068 2.14e-4 SMART
SPEC 3075 3179 3.01e-8 SMART
SPEC 3186 3288 4.48e-16 SMART
SPEC 3295 3397 4.15e-11 SMART
SPEC 3404 3506 7.07e-5 SMART
SPEC 3513 3615 2.26e-3 SMART
SPEC 3622 3724 4.29e-4 SMART
SPEC 3731 3832 9.99e-14 SMART
SPEC 3839 3945 5.79e-2 SMART
SPEC 3952 4054 6.59e-14 SMART
SPEC 4061 4164 3.7e-17 SMART
SPEC 4171 4273 1.16e-23 SMART
SPEC 4280 4383 3.58e-15 SMART
SPEC 4390 4492 2.61e-17 SMART
SPEC 4499 4602 9.38e-19 SMART
SPEC 4609 4710 2.29e-22 SMART
SPEC 4717 4819 4.99e-14 SMART
SPEC 4826 4956 1.45e-10 SMART
EFh 4990 5018 5.08e-3 SMART
EFh 5026 5054 1.17e-2 SMART
GAS2 5065 5137 2.28e-54 SMART
low complexity region 5159 5204 N/A INTRINSIC
low complexity region 5253 5278 N/A INTRINSIC
low complexity region 5295 5307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134458
AA Change: M2040V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119885
Gene: ENSMUSG00000028649
AA Change: M2040V

DomainStartEndE-ValueType
PDB:3R6N|B 3 168 5e-37 PDB
coiled coil region 178 199 N/A INTRINSIC
SPEC 410 539 2.35e0 SMART
SPEC 557 665 1.12e-7 SMART
SPEC 682 790 3.94e-3 SMART
SPEC 950 1060 4.03e-9 SMART
SPEC 1067 1173 1.75e-9 SMART
SPEC 1180 1282 5.57e-3 SMART
SPEC 1289 1388 4.56e0 SMART
SPEC 1395 1505 3.18e-1 SMART
SPEC 1512 1617 1.29e-7 SMART
SPEC 1624 1728 1.19e-2 SMART
SPEC 1735 1838 2.7e-1 SMART
SPEC 1845 1948 4.99e-14 SMART
SPEC 1955 2055 1.9e-5 SMART
SPEC 2062 2168 2.83e0 SMART
SPEC 2171 2273 2.14e-4 SMART
SPEC 2280 2384 3.01e-8 SMART
SPEC 2391 2493 4.48e-16 SMART
SPEC 2500 2602 1.26e-10 SMART
SPEC 2609 2711 2.26e-3 SMART
SPEC 2718 2820 4.29e-4 SMART
SPEC 2827 2928 9.99e-14 SMART
SPEC 2935 3041 5.79e-2 SMART
SPEC 3048 3150 6.59e-14 SMART
SPEC 3157 3260 3.7e-17 SMART
SPEC 3267 3369 1.16e-23 SMART
SPEC 3376 3479 3.58e-15 SMART
SPEC 3486 3588 2.61e-17 SMART
SPEC 3595 3698 9.38e-19 SMART
SPEC 3705 3806 2.29e-22 SMART
SPEC 3813 3915 4.99e-14 SMART
SPEC 3922 4052 1.45e-10 SMART
EFh 4086 4114 5.08e-3 SMART
EFh 4122 4150 1.17e-2 SMART
GAS2 4161 4233 2.28e-54 SMART
low complexity region 4255 4300 N/A INTRINSIC
low complexity region 4349 4374 N/A INTRINSIC
low complexity region 4391 4403 N/A INTRINSIC
Meta Mutation Damage Score 0.0955 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 99% (71/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit lethality before somitogenesis with failure of the primitive streak to form. Mice heterozygous for a knock-out and floxed allele activated in neurons exhibit impaired cortical neuron migration, respiratory distress, and early postnatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(784) : Targeted(4) Gene trapped(780)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,575,565 (GRCm39) probably benign Het
Abca16 T A 7: 120,139,378 (GRCm39) L1470Q probably damaging Het
Abraxas2 G A 7: 132,476,584 (GRCm39) R105Q probably damaging Het
Becn1 A G 11: 101,181,324 (GRCm39) Y326H probably damaging Het
Bicd1 T C 6: 149,414,448 (GRCm39) I387T probably benign Het
Btbd9 C T 17: 30,493,916 (GRCm39) D492N possibly damaging Het
Cacna1g T A 11: 94,300,302 (GRCm39) H2156L probably damaging Het
Cd22 A G 7: 30,566,533 (GRCm39) probably benign Het
Cd59b G A 2: 103,909,286 (GRCm39) probably null Het
Chn2 T C 6: 54,267,436 (GRCm39) probably benign Het
Cmya5 A G 13: 93,232,412 (GRCm39) L892P possibly damaging Het
Col5a2 A G 1: 45,446,195 (GRCm39) I461T probably benign Het
Cts8 T A 13: 61,401,391 (GRCm39) M75L probably benign Het
Ddx50 A T 10: 62,457,156 (GRCm39) probably benign Het
Dlg5 T C 14: 24,197,274 (GRCm39) M1558V probably benign Het
Dnlz T C 2: 26,241,380 (GRCm39) N116S probably damaging Het
Efcab14 T C 4: 115,597,728 (GRCm39) F108L probably damaging Het
Ell2 T C 13: 75,910,259 (GRCm39) probably benign Het
Fam234b T G 6: 135,194,072 (GRCm39) S242A possibly damaging Het
Fhip2a G A 19: 57,369,839 (GRCm39) D461N probably benign Het
Garnl3 T C 2: 32,896,816 (GRCm39) T608A possibly damaging Het
Gata3 T C 2: 9,879,620 (GRCm39) T119A probably benign Het
Hdac2 T A 10: 36,865,180 (GRCm39) D131E probably benign Het
Hira T A 16: 18,774,921 (GRCm39) F949I probably benign Het
Il3 A G 11: 54,156,506 (GRCm39) probably null Het
Itgb3 A T 11: 104,527,914 (GRCm39) K216N probably damaging Het
Jkampl A G 6: 73,446,402 (GRCm39) L49P possibly damaging Het
Kctd21 T A 7: 96,997,298 (GRCm39) I257N probably benign Het
Kif16b A T 2: 142,514,295 (GRCm39) S1215T probably benign Het
Lhx9 A T 1: 138,766,417 (GRCm39) C124S probably damaging Het
Lrch3 T A 16: 32,782,124 (GRCm39) probably benign Het
Lrp1b T C 2: 40,486,995 (GRCm39) E142G probably damaging Het
Mndal A T 1: 173,685,079 (GRCm39) probably benign Het
Mug2 G T 6: 122,051,673 (GRCm39) V952L possibly damaging Het
Nepn A T 10: 52,276,533 (GRCm39) T29S probably damaging Het
Nlgn1 C T 3: 25,490,089 (GRCm39) C546Y probably damaging Het
Notch4 C T 17: 34,784,337 (GRCm39) R43W possibly damaging Het
Nrxn1 A T 17: 91,302,915 (GRCm39) probably null Het
Or14a260 A G 7: 85,984,803 (GRCm39) I267T probably benign Het
Or8k53 T C 2: 86,178,072 (GRCm39) I13V possibly damaging Het
Phf3 A T 1: 30,844,146 (GRCm39) D1604E probably benign Het
Plekhn1 T C 4: 156,312,700 (GRCm39) R53G probably benign Het
Pnp2 T C 14: 51,200,634 (GRCm39) F100S probably damaging Het
Rimoc1 T C 15: 4,015,776 (GRCm39) K263E probably damaging Het
Rxfp1 A G 3: 79,564,783 (GRCm39) S327P probably damaging Het
Siah2 A G 3: 58,583,536 (GRCm39) V250A probably damaging Het
Slc10a7 T A 8: 79,423,787 (GRCm39) probably null Het
Slc9a1 A G 4: 133,147,916 (GRCm39) K645E probably benign Het
Smarca4 T C 9: 21,548,620 (GRCm39) L302P probably damaging Het
Tas2r120 T A 6: 132,634,552 (GRCm39) Y211* probably null Het
Tenm3 A T 8: 49,127,507 (GRCm39) L57Q probably damaging Het
Tep1 C T 14: 51,067,150 (GRCm39) V2269I possibly damaging Het
Tpd52l1 A G 10: 31,255,252 (GRCm39) S32P probably damaging Het
Tsfm A G 10: 126,858,798 (GRCm39) probably benign Het
Ttn T A 2: 76,540,468 (GRCm39) R34173W probably damaging Het
Ttn C A 2: 76,623,474 (GRCm39) V15368L possibly damaging Het
Upk1a A T 7: 30,311,819 (GRCm39) I25N possibly damaging Het
Vmn1r45 A T 6: 89,910,492 (GRCm39) Y159* probably null Het
Vmn2r13 C A 5: 109,322,915 (GRCm39) V125L probably benign Het
Vps13b T C 15: 35,887,407 (GRCm39) I3272T probably benign Het
Zfp108 A G 7: 23,959,892 (GRCm39) H161R probably benign Het
Zfp982 A T 4: 147,597,093 (GRCm39) K150I probably benign Het
Zfyve1 A G 12: 83,601,847 (GRCm39) probably benign Het
Zswim8 T C 14: 20,766,558 (GRCm39) probably benign Het
Other mutations in Macf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Macf1 APN 4 123,275,915 (GRCm39) missense probably damaging 0.99
IGL01293:Macf1 APN 4 123,365,104 (GRCm39) missense probably benign 0.00
IGL01307:Macf1 APN 4 123,276,922 (GRCm39) missense probably damaging 1.00
IGL01314:Macf1 APN 4 123,380,513 (GRCm39) missense probably damaging 1.00
IGL01321:Macf1 APN 4 123,334,567 (GRCm39) missense probably damaging 1.00
IGL01327:Macf1 APN 4 123,403,705 (GRCm39) missense probably benign 0.20
IGL01365:Macf1 APN 4 123,284,962 (GRCm39) missense probably damaging 1.00
IGL01465:Macf1 APN 4 123,384,514 (GRCm39) missense probably benign 0.00
IGL01527:Macf1 APN 4 123,386,953 (GRCm39) missense possibly damaging 0.93
IGL01533:Macf1 APN 4 123,367,666 (GRCm39) missense probably damaging 1.00
IGL01539:Macf1 APN 4 123,289,701 (GRCm39) splice site probably benign
IGL01543:Macf1 APN 4 123,295,250 (GRCm39) missense probably damaging 1.00
IGL01553:Macf1 APN 4 123,386,956 (GRCm39) nonsense probably null
IGL01558:Macf1 APN 4 123,346,798 (GRCm39) missense probably benign 0.00
IGL01633:Macf1 APN 4 123,395,964 (GRCm39) missense probably damaging 0.99
IGL01684:Macf1 APN 4 123,359,723 (GRCm39) missense probably damaging 1.00
IGL01715:Macf1 APN 4 123,284,879 (GRCm39) missense probably damaging 1.00
IGL01844:Macf1 APN 4 123,334,485 (GRCm39) missense probably benign 0.34
IGL01870:Macf1 APN 4 123,367,906 (GRCm39) missense probably damaging 0.99
IGL01916:Macf1 APN 4 123,335,423 (GRCm39) missense probably damaging 1.00
IGL01916:Macf1 APN 4 123,369,830 (GRCm39) missense probably damaging 1.00
IGL01923:Macf1 APN 4 123,274,237 (GRCm39) missense possibly damaging 0.46
IGL02017:Macf1 APN 4 123,393,724 (GRCm39) missense probably damaging 1.00
IGL02022:Macf1 APN 4 123,284,842 (GRCm39) critical splice donor site probably null
IGL02084:Macf1 APN 4 123,326,396 (GRCm39) missense probably benign 0.02
IGL02084:Macf1 APN 4 123,353,167 (GRCm39) missense probably damaging 1.00
IGL02142:Macf1 APN 4 123,365,842 (GRCm39) missense probably benign 0.11
IGL02151:Macf1 APN 4 123,265,559 (GRCm39) splice site probably benign
IGL02164:Macf1 APN 4 123,374,065 (GRCm39) missense probably benign 0.03
IGL02174:Macf1 APN 4 123,385,587 (GRCm39) missense probably damaging 1.00
IGL02229:Macf1 APN 4 123,403,619 (GRCm39) missense probably damaging 1.00
IGL02277:Macf1 APN 4 123,380,497 (GRCm39) missense probably damaging 1.00
IGL02283:Macf1 APN 4 123,365,168 (GRCm39) missense probably benign 0.01
IGL02314:Macf1 APN 4 123,338,630 (GRCm39) missense probably damaging 0.99
IGL02327:Macf1 APN 4 123,365,523 (GRCm39) missense probably benign 0.06
IGL02348:Macf1 APN 4 123,406,659 (GRCm39) missense probably damaging 1.00
IGL02441:Macf1 APN 4 123,281,029 (GRCm39) missense probably damaging 1.00
IGL02585:Macf1 APN 4 123,366,077 (GRCm39) missense probably benign 0.00
IGL02602:Macf1 APN 4 123,248,956 (GRCm39) missense probably damaging 1.00
IGL03204:Macf1 APN 4 123,249,070 (GRCm39) splice site probably benign
anakex UTSW 4 123,302,064 (GRCm39) missense probably damaging 0.97
esfuerzo UTSW 4 123,369,922 (GRCm39) missense probably benign 0.22
Royal_flush UTSW 4 123,259,148 (GRCm39) splice site probably null
standard UTSW 4 123,380,199 (GRCm39) missense probably damaging 1.00
suspension UTSW 4 123,391,548 (GRCm39) missense probably damaging 1.00
voragine UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
BB010:Macf1 UTSW 4 123,303,444 (GRCm39) missense probably benign 0.00
BB020:Macf1 UTSW 4 123,303,444 (GRCm39) missense probably benign 0.00
H8562:Macf1 UTSW 4 123,359,833 (GRCm39) missense probably benign 0.13
IGL03052:Macf1 UTSW 4 123,281,188 (GRCm39) missense probably damaging 1.00
N/A - 535:Macf1 UTSW 4 123,367,601 (GRCm39) missense possibly damaging 0.82
PIT4576001:Macf1 UTSW 4 123,367,114 (GRCm39) missense probably benign 0.43
R0021:Macf1 UTSW 4 123,369,370 (GRCm39) missense probably damaging 1.00
R0023:Macf1 UTSW 4 123,382,107 (GRCm39) splice site probably benign
R0023:Macf1 UTSW 4 123,382,107 (GRCm39) splice site probably benign
R0028:Macf1 UTSW 4 123,275,895 (GRCm39) missense probably damaging 1.00
R0066:Macf1 UTSW 4 123,325,943 (GRCm39) nonsense probably null
R0066:Macf1 UTSW 4 123,325,943 (GRCm39) nonsense probably null
R0067:Macf1 UTSW 4 123,369,041 (GRCm39) missense possibly damaging 0.90
R0067:Macf1 UTSW 4 123,369,041 (GRCm39) missense possibly damaging 0.90
R0078:Macf1 UTSW 4 123,367,661 (GRCm39) missense probably damaging 1.00
R0106:Macf1 UTSW 4 123,302,357 (GRCm39) missense probably benign 0.00
R0129:Macf1 UTSW 4 123,327,068 (GRCm39) missense probably damaging 1.00
R0134:Macf1 UTSW 4 123,326,636 (GRCm39) missense possibly damaging 0.78
R0138:Macf1 UTSW 4 123,334,540 (GRCm39) missense probably damaging 1.00
R0145:Macf1 UTSW 4 123,281,190 (GRCm39) missense probably damaging 1.00
R0195:Macf1 UTSW 4 123,328,709 (GRCm39) missense probably damaging 0.99
R0227:Macf1 UTSW 4 123,293,184 (GRCm39) missense probably benign 0.14
R0233:Macf1 UTSW 4 123,343,920 (GRCm39) splice site probably benign
R0254:Macf1 UTSW 4 123,326,572 (GRCm39) missense probably damaging 1.00
R0357:Macf1 UTSW 4 123,351,776 (GRCm39) missense probably damaging 1.00
R0398:Macf1 UTSW 4 123,244,810 (GRCm39) missense probably damaging 1.00
R0413:Macf1 UTSW 4 123,366,062 (GRCm39) missense probably benign
R0426:Macf1 UTSW 4 123,377,453 (GRCm39) nonsense probably null
R0441:Macf1 UTSW 4 123,259,148 (GRCm39) splice site probably null
R0453:Macf1 UTSW 4 123,338,737 (GRCm39) missense probably benign 0.35
R0481:Macf1 UTSW 4 123,377,815 (GRCm39) splice site probably null
R0502:Macf1 UTSW 4 123,363,608 (GRCm39) missense probably damaging 1.00
R0503:Macf1 UTSW 4 123,363,608 (GRCm39) missense probably damaging 1.00
R0519:Macf1 UTSW 4 123,365,113 (GRCm39) missense probably benign 0.03
R0543:Macf1 UTSW 4 123,270,171 (GRCm39) missense probably damaging 1.00
R0621:Macf1 UTSW 4 123,274,327 (GRCm39) missense probably damaging 1.00
R0631:Macf1 UTSW 4 123,349,317 (GRCm39) nonsense probably null
R0720:Macf1 UTSW 4 123,326,718 (GRCm39) missense probably damaging 1.00
R0730:Macf1 UTSW 4 123,276,323 (GRCm39) splice site probably benign
R0755:Macf1 UTSW 4 123,263,719 (GRCm39) missense probably damaging 0.99
R0836:Macf1 UTSW 4 123,388,675 (GRCm39) critical splice donor site probably null
R0847:Macf1 UTSW 4 123,293,159 (GRCm39) missense probably benign 0.03
R0850:Macf1 UTSW 4 123,368,195 (GRCm39) missense probably benign
R0924:Macf1 UTSW 4 123,279,271 (GRCm39) missense probably damaging 1.00
R0973:Macf1 UTSW 4 123,369,793 (GRCm39) missense possibly damaging 0.76
R1025:Macf1 UTSW 4 123,367,609 (GRCm39) missense probably damaging 1.00
R1076:Macf1 UTSW 4 123,279,391 (GRCm39) missense probably damaging 1.00
R1253:Macf1 UTSW 4 123,351,760 (GRCm39) missense probably damaging 1.00
R1301:Macf1 UTSW 4 123,380,451 (GRCm39) splice site probably benign
R1337:Macf1 UTSW 4 123,370,068 (GRCm39) missense probably benign 0.34
R1344:Macf1 UTSW 4 123,327,246 (GRCm39) missense probably damaging 0.99
R1404:Macf1 UTSW 4 123,270,309 (GRCm39) missense probably damaging 1.00
R1404:Macf1 UTSW 4 123,270,309 (GRCm39) missense probably damaging 1.00
R1443:Macf1 UTSW 4 123,404,800 (GRCm39) missense probably damaging 1.00
R1452:Macf1 UTSW 4 123,387,791 (GRCm39) missense probably benign
R1465:Macf1 UTSW 4 123,386,947 (GRCm39) missense probably damaging 0.98
R1465:Macf1 UTSW 4 123,386,947 (GRCm39) missense probably damaging 0.98
R1483:Macf1 UTSW 4 123,404,770 (GRCm39) missense probably damaging 1.00
R1509:Macf1 UTSW 4 123,577,802 (GRCm39) missense possibly damaging 0.92
R1510:Macf1 UTSW 4 123,328,555 (GRCm39) missense probably null 1.00
R1515:Macf1 UTSW 4 123,272,273 (GRCm39) missense probably damaging 1.00
R1524:Macf1 UTSW 4 123,326,323 (GRCm39) missense possibly damaging 0.75
R1528:Macf1 UTSW 4 123,369,807 (GRCm39) missense probably benign 0.30
R1535:Macf1 UTSW 4 123,334,486 (GRCm39) missense probably benign 0.05
R1556:Macf1 UTSW 4 123,348,813 (GRCm39) missense probably damaging 1.00
R1564:Macf1 UTSW 4 123,353,150 (GRCm39) missense probably benign 0.00
R1586:Macf1 UTSW 4 123,403,639 (GRCm39) missense probably benign 0.20
R1626:Macf1 UTSW 4 123,365,327 (GRCm39) missense probably benign
R1629:Macf1 UTSW 4 123,402,208 (GRCm39) nonsense probably null
R1649:Macf1 UTSW 4 123,377,846 (GRCm39) missense probably damaging 0.96
R1650:Macf1 UTSW 4 123,350,393 (GRCm39) nonsense probably null
R1706:Macf1 UTSW 4 123,264,377 (GRCm39) critical splice donor site probably null
R1713:Macf1 UTSW 4 123,272,487 (GRCm39) missense probably damaging 1.00
R1716:Macf1 UTSW 4 123,295,196 (GRCm39) missense probably damaging 1.00
R1744:Macf1 UTSW 4 123,369,646 (GRCm39) missense probably damaging 1.00
R1752:Macf1 UTSW 4 123,377,465 (GRCm39) missense possibly damaging 0.92
R1771:Macf1 UTSW 4 123,405,901 (GRCm39) missense probably damaging 1.00
R1812:Macf1 UTSW 4 123,325,817 (GRCm39) missense probably damaging 1.00
R1818:Macf1 UTSW 4 123,270,210 (GRCm39) missense probably damaging 1.00
R1853:Macf1 UTSW 4 123,406,513 (GRCm39) splice site probably null
R1856:Macf1 UTSW 4 123,263,641 (GRCm39) missense probably damaging 1.00
R1869:Macf1 UTSW 4 123,244,921 (GRCm39) missense probably damaging 1.00
R1880:Macf1 UTSW 4 123,332,384 (GRCm39) missense probably damaging 1.00
R1888:Macf1 UTSW 4 123,368,505 (GRCm39) missense probably benign
R1888:Macf1 UTSW 4 123,368,505 (GRCm39) missense probably benign
R1888:Macf1 UTSW 4 123,348,835 (GRCm39) missense possibly damaging 0.91
R1888:Macf1 UTSW 4 123,348,835 (GRCm39) missense possibly damaging 0.91
R1902:Macf1 UTSW 4 123,364,958 (GRCm39) missense probably benign 0.01
R1907:Macf1 UTSW 4 123,266,192 (GRCm39) missense probably damaging 1.00
R1908:Macf1 UTSW 4 123,351,634 (GRCm39) missense possibly damaging 0.67
R1932:Macf1 UTSW 4 123,345,830 (GRCm39) missense probably damaging 1.00
R1944:Macf1 UTSW 4 123,264,459 (GRCm39) missense probably damaging 1.00
R1945:Macf1 UTSW 4 123,384,453 (GRCm39) nonsense probably null
R1975:Macf1 UTSW 4 123,383,005 (GRCm39) missense probably damaging 1.00
R1989:Macf1 UTSW 4 123,391,519 (GRCm39) critical splice donor site probably null
R1991:Macf1 UTSW 4 123,350,488 (GRCm39) missense probably damaging 1.00
R1992:Macf1 UTSW 4 123,350,488 (GRCm39) missense probably damaging 1.00
R2013:Macf1 UTSW 4 123,577,807 (GRCm39) missense probably damaging 1.00
R2021:Macf1 UTSW 4 123,366,523 (GRCm39) missense probably damaging 1.00
R2022:Macf1 UTSW 4 123,366,523 (GRCm39) missense probably damaging 1.00
R2023:Macf1 UTSW 4 123,366,523 (GRCm39) missense probably damaging 1.00
R2024:Macf1 UTSW 4 123,265,711 (GRCm39) missense probably damaging 1.00
R2025:Macf1 UTSW 4 123,265,711 (GRCm39) missense probably damaging 1.00
R2027:Macf1 UTSW 4 123,265,711 (GRCm39) missense probably damaging 1.00
R2049:Macf1 UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
R2060:Macf1 UTSW 4 123,393,712 (GRCm39) splice site probably null
R2092:Macf1 UTSW 4 123,276,971 (GRCm39) missense probably damaging 1.00
R2100:Macf1 UTSW 4 123,291,699 (GRCm39) nonsense probably null
R2128:Macf1 UTSW 4 123,386,567 (GRCm39) missense probably benign 0.11
R2129:Macf1 UTSW 4 123,262,608 (GRCm39) splice site probably benign
R2140:Macf1 UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
R2142:Macf1 UTSW 4 123,248,895 (GRCm39) missense probably damaging 1.00
R2182:Macf1 UTSW 4 123,386,464 (GRCm39) missense probably damaging 0.98
R2185:Macf1 UTSW 4 123,369,349 (GRCm39) missense probably damaging 0.99
R2190:Macf1 UTSW 4 123,353,005 (GRCm39) missense probably benign 0.11
R2320:Macf1 UTSW 4 123,333,288 (GRCm39) missense probably benign 0.02
R2382:Macf1 UTSW 4 123,268,625 (GRCm39) missense probably damaging 1.00
R2429:Macf1 UTSW 4 123,326,377 (GRCm39) missense probably damaging 0.99
R2432:Macf1 UTSW 4 123,577,789 (GRCm39) missense probably damaging 1.00
R2484:Macf1 UTSW 4 123,367,465 (GRCm39) missense probably damaging 1.00
R2842:Macf1 UTSW 4 123,270,210 (GRCm39) missense probably damaging 1.00
R2912:Macf1 UTSW 4 123,369,704 (GRCm39) missense probably damaging 1.00
R2913:Macf1 UTSW 4 123,369,704 (GRCm39) missense probably damaging 1.00
R2914:Macf1 UTSW 4 123,369,704 (GRCm39) missense probably damaging 1.00
R2938:Macf1 UTSW 4 123,326,695 (GRCm39) missense probably damaging 0.99
R3082:Macf1 UTSW 4 123,255,236 (GRCm39) splice site probably null
R3086:Macf1 UTSW 4 123,328,901 (GRCm39) missense probably benign 0.00
R3408:Macf1 UTSW 4 123,275,574 (GRCm39) missense probably damaging 1.00
R3499:Macf1 UTSW 4 123,421,098 (GRCm39) nonsense probably null
R3696:Macf1 UTSW 4 123,350,155 (GRCm39) missense probably damaging 1.00
R3716:Macf1 UTSW 4 123,367,295 (GRCm39) missense probably benign 0.01
R3727:Macf1 UTSW 4 123,353,104 (GRCm39) missense probably damaging 1.00
R3770:Macf1 UTSW 4 123,268,560 (GRCm39) missense probably damaging 1.00
R3813:Macf1 UTSW 4 123,268,560 (GRCm39) missense probably damaging 1.00
R3825:Macf1 UTSW 4 123,338,744 (GRCm39) missense probably benign 0.11
R3893:Macf1 UTSW 4 123,380,199 (GRCm39) missense probably damaging 1.00
R3896:Macf1 UTSW 4 123,364,987 (GRCm39) missense possibly damaging 0.55
R3947:Macf1 UTSW 4 123,274,213 (GRCm39) missense probably damaging 1.00
R4031:Macf1 UTSW 4 123,275,105 (GRCm39) missense probably damaging 1.00
R4052:Macf1 UTSW 4 123,365,810 (GRCm39) missense probably benign 0.00
R4077:Macf1 UTSW 4 123,365,884 (GRCm39) missense probably benign 0.07
R4078:Macf1 UTSW 4 123,365,884 (GRCm39) missense probably benign 0.07
R4084:Macf1 UTSW 4 123,343,865 (GRCm39) missense probably damaging 0.98
R4094:Macf1 UTSW 4 123,353,062 (GRCm39) missense probably benign 0.00
R4154:Macf1 UTSW 4 123,365,606 (GRCm39) missense probably damaging 1.00
R4190:Macf1 UTSW 4 123,366,835 (GRCm39) missense possibly damaging 0.95
R4191:Macf1 UTSW 4 123,366,835 (GRCm39) missense possibly damaging 0.95
R4192:Macf1 UTSW 4 123,366,835 (GRCm39) missense possibly damaging 0.95
R4232:Macf1 UTSW 4 123,326,185 (GRCm39) missense probably damaging 1.00
R4299:Macf1 UTSW 4 123,293,199 (GRCm39) missense probably damaging 1.00
R4326:Macf1 UTSW 4 123,276,005 (GRCm39) missense probably damaging 1.00
R4327:Macf1 UTSW 4 123,276,005 (GRCm39) missense probably damaging 1.00
R4355:Macf1 UTSW 4 123,368,884 (GRCm39) missense possibly damaging 0.79
R4380:Macf1 UTSW 4 123,248,285 (GRCm39) intron probably benign
R4422:Macf1 UTSW 4 123,359,839 (GRCm39) missense probably damaging 0.96
R4436:Macf1 UTSW 4 123,421,135 (GRCm39) missense probably benign 0.03
R4472:Macf1 UTSW 4 123,289,782 (GRCm39) missense probably damaging 1.00
R4515:Macf1 UTSW 4 123,387,781 (GRCm39) missense probably damaging 1.00
R4549:Macf1 UTSW 4 123,367,486 (GRCm39) missense possibly damaging 0.75
R4621:Macf1 UTSW 4 123,266,141 (GRCm39) critical splice donor site probably null
R4622:Macf1 UTSW 4 123,266,141 (GRCm39) critical splice donor site probably null
R4623:Macf1 UTSW 4 123,266,141 (GRCm39) critical splice donor site probably null
R4630:Macf1 UTSW 4 123,367,432 (GRCm39) missense possibly damaging 0.84
R4647:Macf1 UTSW 4 123,367,420 (GRCm39) missense probably benign 0.01
R4650:Macf1 UTSW 4 123,367,412 (GRCm39) missense probably benign 0.00
R4674:Macf1 UTSW 4 123,366,190 (GRCm39) missense probably benign 0.22
R4751:Macf1 UTSW 4 123,365,443 (GRCm39) missense probably benign 0.01
R4762:Macf1 UTSW 4 123,349,237 (GRCm39) missense probably benign 0.00
R4776:Macf1 UTSW 4 123,369,808 (GRCm39) missense probably benign 0.00
R4777:Macf1 UTSW 4 123,270,295 (GRCm39) missense probably damaging 1.00
R4860:Macf1 UTSW 4 123,380,543 (GRCm39) missense probably damaging 1.00
R4860:Macf1 UTSW 4 123,380,543 (GRCm39) missense probably damaging 1.00
R4865:Macf1 UTSW 4 123,327,096 (GRCm39) missense probably damaging 1.00
R4867:Macf1 UTSW 4 123,365,993 (GRCm39) missense probably damaging 0.97
R4884:Macf1 UTSW 4 123,348,802 (GRCm39) missense probably benign 0.02
R4890:Macf1 UTSW 4 123,342,031 (GRCm39) missense probably damaging 1.00
R4913:Macf1 UTSW 4 123,393,682 (GRCm39) missense probably damaging 1.00
R4925:Macf1 UTSW 4 123,420,445 (GRCm39) missense probably benign
R4948:Macf1 UTSW 4 123,391,548 (GRCm39) missense probably damaging 1.00
R4958:Macf1 UTSW 4 123,369,157 (GRCm39) missense probably damaging 0.99
R4986:Macf1 UTSW 4 123,284,914 (GRCm39) missense probably damaging 1.00
R4999:Macf1 UTSW 4 123,388,702 (GRCm39) missense probably benign 0.14
R5004:Macf1 UTSW 4 123,279,268 (GRCm39) missense probably damaging 1.00
R5017:Macf1 UTSW 4 123,345,906 (GRCm39) missense probably damaging 1.00
R5018:Macf1 UTSW 4 123,279,392 (GRCm39) missense probably damaging 1.00
R5026:Macf1 UTSW 4 123,333,287 (GRCm39) missense possibly damaging 0.95
R5037:Macf1 UTSW 4 123,349,312 (GRCm39) missense probably damaging 0.97
R5039:Macf1 UTSW 4 123,405,013 (GRCm39) missense probably damaging 1.00
R5041:Macf1 UTSW 4 123,290,839 (GRCm39) splice site probably null
R5100:Macf1 UTSW 4 123,368,261 (GRCm39) missense probably benign 0.11
R5110:Macf1 UTSW 4 123,261,801 (GRCm39) missense probably damaging 0.99
R5122:Macf1 UTSW 4 123,346,085 (GRCm39) missense probably damaging 1.00
R5187:Macf1 UTSW 4 123,365,882 (GRCm39) missense probably benign 0.00
R5191:Macf1 UTSW 4 123,366,755 (GRCm39) missense probably benign 0.00
R5201:Macf1 UTSW 4 123,369,738 (GRCm39) nonsense probably null
R5236:Macf1 UTSW 4 123,291,614 (GRCm39) missense probably damaging 1.00
R5248:Macf1 UTSW 4 123,295,567 (GRCm39) nonsense probably null
R5251:Macf1 UTSW 4 123,343,760 (GRCm39) missense probably benign 0.20
R5319:Macf1 UTSW 4 123,367,229 (GRCm39) missense probably damaging 1.00
R5326:Macf1 UTSW 4 123,244,784 (GRCm39) frame shift probably null
R5327:Macf1 UTSW 4 123,244,784 (GRCm39) frame shift probably null
R5328:Macf1 UTSW 4 123,244,784 (GRCm39) frame shift probably null
R5350:Macf1 UTSW 4 123,421,251 (GRCm39) start codon destroyed probably null 0.02
R5390:Macf1 UTSW 4 123,365,546 (GRCm39) missense probably damaging 0.98
R5419:Macf1 UTSW 4 123,290,917 (GRCm39) missense possibly damaging 0.70
R5428:Macf1 UTSW 4 123,278,661 (GRCm39) missense probably damaging 1.00
R5432:Macf1 UTSW 4 123,353,129 (GRCm39) nonsense probably null
R5466:Macf1 UTSW 4 123,346,658 (GRCm39) missense possibly damaging 0.75
R5472:Macf1 UTSW 4 123,343,854 (GRCm39) missense probably benign
R5564:Macf1 UTSW 4 123,420,538 (GRCm39) missense possibly damaging 0.92
R5566:Macf1 UTSW 4 123,328,957 (GRCm39) missense probably damaging 0.98
R5597:Macf1 UTSW 4 123,433,570 (GRCm39) intron probably benign
R5669:Macf1 UTSW 4 123,370,018 (GRCm39) missense probably damaging 1.00
R5682:Macf1 UTSW 4 123,328,552 (GRCm39) missense probably damaging 1.00
R5701:Macf1 UTSW 4 123,397,018 (GRCm39) missense probably damaging 1.00
R5715:Macf1 UTSW 4 123,577,807 (GRCm39) missense probably damaging 1.00
R5760:Macf1 UTSW 4 123,407,677 (GRCm39) missense probably damaging 1.00
R5806:Macf1 UTSW 4 123,265,680 (GRCm39) missense probably damaging 1.00
R5838:Macf1 UTSW 4 123,345,947 (GRCm39) missense possibly damaging 0.95
R5839:Macf1 UTSW 4 123,275,117 (GRCm39) missense probably damaging 1.00
R5850:Macf1 UTSW 4 123,401,099 (GRCm39) missense probably damaging 1.00
R5875:Macf1 UTSW 4 123,326,107 (GRCm39) missense possibly damaging 0.78
R5912:Macf1 UTSW 4 123,290,951 (GRCm39) missense probably damaging 1.00
R5913:Macf1 UTSW 4 123,369,832 (GRCm39) missense probably damaging 1.00
R5921:Macf1 UTSW 4 123,420,504 (GRCm39) missense probably benign
R5940:Macf1 UTSW 4 123,326,674 (GRCm39) missense probably damaging 1.00
R5950:Macf1 UTSW 4 123,333,229 (GRCm39) splice site probably null
R6005:Macf1 UTSW 4 123,368,068 (GRCm39) missense possibly damaging 0.82
R6029:Macf1 UTSW 4 123,401,126 (GRCm39) missense probably damaging 1.00
R6041:Macf1 UTSW 4 123,407,641 (GRCm39) missense probably damaging 1.00
R6057:Macf1 UTSW 4 123,404,536 (GRCm39) missense probably damaging 0.98
R6156:Macf1 UTSW 4 123,366,073 (GRCm39) missense probably benign 0.00
R6186:Macf1 UTSW 4 123,377,968 (GRCm39) missense probably damaging 1.00
R6197:Macf1 UTSW 4 123,346,085 (GRCm39) missense probably damaging 1.00
R6262:Macf1 UTSW 4 123,366,983 (GRCm39) missense possibly damaging 0.79
R6296:Macf1 UTSW 4 123,326,668 (GRCm39) missense probably damaging 1.00
R6340:Macf1 UTSW 4 123,342,042 (GRCm39) missense probably benign 0.13
R6369:Macf1 UTSW 4 123,304,355 (GRCm39) missense possibly damaging 0.90
R6414:Macf1 UTSW 4 123,386,988 (GRCm39) missense possibly damaging 0.93
R6429:Macf1 UTSW 4 123,295,387 (GRCm39) splice site probably null
R6501:Macf1 UTSW 4 123,363,425 (GRCm39) splice site probably null
R6508:Macf1 UTSW 4 123,363,535 (GRCm39) missense probably damaging 0.96
R6519:Macf1 UTSW 4 123,366,118 (GRCm39) missense probably benign 0.13
R6535:Macf1 UTSW 4 123,365,728 (GRCm39) missense possibly damaging 0.82
R6537:Macf1 UTSW 4 123,386,518 (GRCm39) missense probably damaging 1.00
R6546:Macf1 UTSW 4 123,326,074 (GRCm39) missense probably benign 0.14
R6583:Macf1 UTSW 4 123,364,739 (GRCm39) splice site probably null
R6597:Macf1 UTSW 4 123,276,485 (GRCm39) missense probably damaging 1.00
R6693:Macf1 UTSW 4 123,367,601 (GRCm39) missense possibly damaging 0.82
R6696:Macf1 UTSW 4 123,403,596 (GRCm39) missense probably damaging 1.00
R6704:Macf1 UTSW 4 123,304,555 (GRCm39) intron probably benign
R6716:Macf1 UTSW 4 123,402,231 (GRCm39) missense probably damaging 1.00
R6789:Macf1 UTSW 4 123,266,231 (GRCm39) missense probably damaging 1.00
R6807:Macf1 UTSW 4 123,268,208 (GRCm39) missense probably damaging 1.00
R6825:Macf1 UTSW 4 123,277,015 (GRCm39) splice site probably null
R6881:Macf1 UTSW 4 123,326,246 (GRCm39) missense probably damaging 1.00
R6894:Macf1 UTSW 4 123,377,480 (GRCm39) missense possibly damaging 0.89
R6924:Macf1 UTSW 4 123,421,145 (GRCm39) missense possibly damaging 0.53
R6962:Macf1 UTSW 4 123,334,515 (GRCm39) missense probably benign 0.01
R6965:Macf1 UTSW 4 123,302,538 (GRCm39) missense probably benign 0.38
R6969:Macf1 UTSW 4 123,351,593 (GRCm39) missense probably benign 0.01
R7032:Macf1 UTSW 4 123,366,101 (GRCm39) missense probably benign 0.00
R7055:Macf1 UTSW 4 123,302,989 (GRCm39) missense probably benign 0.01
R7078:Macf1 UTSW 4 123,325,936 (GRCm39) missense probably damaging 0.99
R7215:Macf1 UTSW 4 123,401,097 (GRCm39) missense probably damaging 1.00
R7263:Macf1 UTSW 4 123,271,943 (GRCm39) missense probably damaging 1.00
R7265:Macf1 UTSW 4 123,301,670 (GRCm39) missense probably benign 0.00
R7278:Macf1 UTSW 4 123,334,536 (GRCm39) missense possibly damaging 0.87
R7312:Macf1 UTSW 4 123,400,130 (GRCm39) missense probably damaging 1.00
R7324:Macf1 UTSW 4 123,268,218 (GRCm39) missense probably benign 0.09
R7334:Macf1 UTSW 4 123,293,235 (GRCm39) missense probably damaging 1.00
R7342:Macf1 UTSW 4 123,275,917 (GRCm39) missense probably damaging 1.00
R7409:Macf1 UTSW 4 123,398,263 (GRCm39) missense probably damaging 1.00
R7436:Macf1 UTSW 4 123,350,436 (GRCm39) missense probably benign
R7440:Macf1 UTSW 4 123,349,239 (GRCm39) nonsense probably null
R7462:Macf1 UTSW 4 123,386,556 (GRCm39) missense probably damaging 1.00
R7471:Macf1 UTSW 4 123,366,082 (GRCm39) missense probably benign 0.00
R7472:Macf1 UTSW 4 123,326,860 (GRCm39) missense probably benign 0.16
R7486:Macf1 UTSW 4 123,303,374 (GRCm39) missense probably benign 0.00
R7492:Macf1 UTSW 4 123,369,524 (GRCm39) missense possibly damaging 0.83
R7511:Macf1 UTSW 4 123,367,093 (GRCm39) missense possibly damaging 0.72
R7528:Macf1 UTSW 4 123,325,852 (GRCm39) missense possibly damaging 0.90
R7547:Macf1 UTSW 4 123,335,410 (GRCm39) missense probably damaging 1.00
R7592:Macf1 UTSW 4 123,304,686 (GRCm39) intron probably benign
R7723:Macf1 UTSW 4 123,326,717 (GRCm39) missense probably benign 0.00
R7731:Macf1 UTSW 4 123,338,672 (GRCm39) missense probably benign 0.19
R7739:Macf1 UTSW 4 123,279,391 (GRCm39) missense probably damaging 1.00
R7740:Macf1 UTSW 4 123,578,096 (GRCm39) start gained probably benign
R7798:Macf1 UTSW 4 123,271,893 (GRCm39) missense probably damaging 1.00
R7799:Macf1 UTSW 4 123,420,906 (GRCm39) missense probably benign 0.00
R7801:Macf1 UTSW 4 123,302,064 (GRCm39) missense probably damaging 0.97
R7842:Macf1 UTSW 4 123,420,702 (GRCm39) missense probably benign 0.12
R7849:Macf1 UTSW 4 123,301,392 (GRCm39) missense probably benign 0.00
R7873:Macf1 UTSW 4 123,398,344 (GRCm39) critical splice acceptor site probably null
R7933:Macf1 UTSW 4 123,303,444 (GRCm39) missense probably benign 0.00
R7934:Macf1 UTSW 4 123,367,727 (GRCm39) missense possibly damaging 0.89
R7947:Macf1 UTSW 4 123,295,200 (GRCm39) missense probably damaging 0.98
R7988:Macf1 UTSW 4 123,400,273 (GRCm39) missense probably damaging 1.00
R7992:Macf1 UTSW 4 123,289,753 (GRCm39) missense probably damaging 1.00
R8013:Macf1 UTSW 4 123,420,619 (GRCm39) missense probably benign 0.00
R8014:Macf1 UTSW 4 123,420,619 (GRCm39) missense probably benign 0.00
R8029:Macf1 UTSW 4 123,338,685 (GRCm39) missense possibly damaging 0.50
R8064:Macf1 UTSW 4 123,353,167 (GRCm39) missense possibly damaging 0.91
R8085:Macf1 UTSW 4 123,303,875 (GRCm39) missense possibly damaging 0.46
R8094:Macf1 UTSW 4 123,263,660 (GRCm39) missense probably damaging 0.99
R8099:Macf1 UTSW 4 123,369,922 (GRCm39) missense probably benign 0.22
R8147:Macf1 UTSW 4 123,385,491 (GRCm39) missense probably damaging 1.00
R8151:Macf1 UTSW 4 123,291,206 (GRCm39) missense possibly damaging 0.91
R8186:Macf1 UTSW 4 123,275,923 (GRCm39) missense possibly damaging 0.89
R8186:Macf1 UTSW 4 123,266,219 (GRCm39) missense probably damaging 1.00
R8192:Macf1 UTSW 4 123,334,390 (GRCm39) missense probably damaging 1.00
R8196:Macf1 UTSW 4 123,276,497 (GRCm39) missense probably damaging 1.00
R8260:Macf1 UTSW 4 123,365,863 (GRCm39) missense probably benign
R8305:Macf1 UTSW 4 123,289,414 (GRCm39) intron probably benign
R8333:Macf1 UTSW 4 123,279,245 (GRCm39) splice site probably null
R8334:Macf1 UTSW 4 123,325,901 (GRCm39) missense possibly damaging 0.82
R8344:Macf1 UTSW 4 123,420,649 (GRCm39) missense probably benign
R8344:Macf1 UTSW 4 123,278,476 (GRCm39) missense probably damaging 1.00
R8422:Macf1 UTSW 4 123,303,279 (GRCm39) missense possibly damaging 0.46
R8459:Macf1 UTSW 4 123,374,107 (GRCm39) missense possibly damaging 0.68
R8466:Macf1 UTSW 4 123,349,237 (GRCm39) missense probably benign 0.00
R8472:Macf1 UTSW 4 123,346,795 (GRCm39) missense probably damaging 1.00
R8556:Macf1 UTSW 4 123,382,136 (GRCm39) missense probably damaging 1.00
R8679:Macf1 UTSW 4 123,405,869 (GRCm39) missense probably benign 0.00
R8723:Macf1 UTSW 4 123,348,910 (GRCm39) nonsense probably null
R8732:Macf1 UTSW 4 123,403,563 (GRCm39) critical splice donor site probably null
R8747:Macf1 UTSW 4 123,248,944 (GRCm39) missense probably damaging 1.00
R8748:Macf1 UTSW 4 123,368,068 (GRCm39) missense probably benign 0.00
R8785:Macf1 UTSW 4 123,342,053 (GRCm39) critical splice acceptor site probably null
R8826:Macf1 UTSW 4 123,276,022 (GRCm39) missense probably damaging 1.00
R8828:Macf1 UTSW 4 123,302,204 (GRCm39) missense probably benign 0.01
R8833:Macf1 UTSW 4 123,365,134 (GRCm39) missense probably benign
R8889:Macf1 UTSW 4 123,249,036 (GRCm39) missense probably damaging 1.00
R8892:Macf1 UTSW 4 123,249,036 (GRCm39) missense probably damaging 1.00
R8893:Macf1 UTSW 4 123,304,323 (GRCm39) missense probably benign 0.27
R8899:Macf1 UTSW 4 123,368,852 (GRCm39) missense probably benign 0.00
R8956:Macf1 UTSW 4 123,368,641 (GRCm39) missense probably benign
R9037:Macf1 UTSW 4 123,365,518 (GRCm39) missense probably benign 0.03
R9086:Macf1 UTSW 4 123,377,944 (GRCm39) missense probably damaging 1.00
R9111:Macf1 UTSW 4 123,406,819 (GRCm39) missense probably damaging 1.00
R9126:Macf1 UTSW 4 123,276,193 (GRCm39) missense possibly damaging 0.88
R9139:Macf1 UTSW 4 123,328,564 (GRCm39) missense probably damaging 1.00
R9140:Macf1 UTSW 4 123,367,855 (GRCm39) missense possibly damaging 0.92
R9149:Macf1 UTSW 4 123,365,326 (GRCm39) missense probably benign 0.40
R9163:Macf1 UTSW 4 123,403,686 (GRCm39) missense probably damaging 1.00
R9177:Macf1 UTSW 4 123,367,582 (GRCm39) missense probably damaging 1.00
R9206:Macf1 UTSW 4 123,577,925 (GRCm39) missense unknown
R9208:Macf1 UTSW 4 123,577,925 (GRCm39) missense unknown
R9209:Macf1 UTSW 4 123,326,227 (GRCm39) missense probably damaging 1.00
R9219:Macf1 UTSW 4 123,301,554 (GRCm39) missense possibly damaging 0.81
R9224:Macf1 UTSW 4 123,326,690 (GRCm39) missense probably damaging 1.00
R9241:Macf1 UTSW 4 123,271,952 (GRCm39) missense probably damaging 1.00
R9268:Macf1 UTSW 4 123,367,582 (GRCm39) missense probably damaging 1.00
R9276:Macf1 UTSW 4 123,328,501 (GRCm39) missense probably damaging 1.00
R9296:Macf1 UTSW 4 123,400,246 (GRCm39) missense probably damaging 0.99
R9369:Macf1 UTSW 4 123,349,150 (GRCm39) critical splice donor site probably null
R9438:Macf1 UTSW 4 123,279,366 (GRCm39) missense probably benign 0.01
R9443:Macf1 UTSW 4 123,365,668 (GRCm39) missense probably benign
R9529:Macf1 UTSW 4 123,407,680 (GRCm39) missense probably damaging 1.00
R9600:Macf1 UTSW 4 123,365,002 (GRCm39) missense possibly damaging 0.76
R9613:Macf1 UTSW 4 123,420,288 (GRCm39) missense probably benign 0.41
R9686:Macf1 UTSW 4 123,377,491 (GRCm39) missense possibly damaging 0.64
R9689:Macf1 UTSW 4 123,365,654 (GRCm39) missense probably benign
R9740:Macf1 UTSW 4 123,366,853 (GRCm39) missense probably damaging 1.00
R9740:Macf1 UTSW 4 123,266,177 (GRCm39) missense probably damaging 1.00
R9764:Macf1 UTSW 4 123,366,136 (GRCm39) missense probably benign 0.02
R9779:Macf1 UTSW 4 123,348,789 (GRCm39) missense probably benign 0.02
RF011:Macf1 UTSW 4 123,367,648 (GRCm39) missense probably damaging 1.00
X0022:Macf1 UTSW 4 123,343,835 (GRCm39) missense probably damaging 0.99
X0027:Macf1 UTSW 4 123,397,062 (GRCm39) missense probably damaging 1.00
X0064:Macf1 UTSW 4 123,405,667 (GRCm39) missense probably damaging 1.00
Z1177:Macf1 UTSW 4 123,365,268 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTACGAGTCCCTGAGTGAAGTTCC -3'
(R):5'- CTGGATAGACGAGTGCAAGTCCAAG -3'

Sequencing Primer
(F):5'- TGCAGCACTTCTTGCTGAG -3'
(R):5'- GATGTCTGAGCTACAGGTTACCC -3'
Protein Function and Prediction

Macf1 encodes ACF7, a member of the spectraplakin family of proteins that function in several processes including gastrulation, wound healing, skin blistering and neuronal degeneration (1;2).  The spectraplakin protiens are cytoskeletal cross-linking proteins that bind both actin and microtubules (1). ACF7 has been shown to be essential in the developing nervous system to coordinate the organization of actin and microtubule networks during axonal growth (2). In addition, ACF7 has been shown to function in wound healing and epidermal migration by acting as an actin-regulated ATPase (3). ACF7 has been shown to function in the translocation and subsequent binding of the Axin complex to LRP6 at the cell membrane upon Wnt stimulation (4). Northern blot analysis detected ubiquitous MACF1 expression; highest expression was in the heart, skeletal muscle, prostate, intestine, colon, and gonads while lowest expression was in brain, spleen, thymus, liver, placenta, and lung (5).  Another study detected high expression of MACF1 in heart, placenta, liver, kidney, and pancreas, moderate expression in brain and lung, and weak expression in skeletal muscle by RT-PCR (6). Immunofluoresense detected ACF7 in a filamentous network throughout the cytoplasm (5).  Additional studies detected ACF7 binds along microtubules, but is concentrated at the distal ends (1).

Macf1tm1Liem/tm1Liem; MGI:3652899

involves: 129S6/SvEvTac * C57BL/6J

Homozygotes exhibit complete embryonic lethality at ~E7.5 and a failure to form a primitive streak (4).

Macf1tm2.1Liem/Macf1tm2.2Liem/Tg(Nes-cre)1Kin; MGI:4831019

involves: 129S6/SvEvTac * C57BL/6 * FVB/N * SJL

Mice heterozygous for a knock-out and floxed allele activated in neurons exhibit impaired cortical neuron migration, respiratory distress, and early postnatal lethality (7).

References
Posted On 2013-04-11
Science Writer Anne Murray