Incidental Mutation 'R1892:Brinp2'
ID211565
Institutional Source Beutler Lab
Gene Symbol Brinp2
Ensembl Gene ENSMUSG00000004031
Gene Namebone morphogenic protein/retinoic acid inducible neural-specific 2
Synonyms6430517E21Rik, Fam5b
MMRRC Submission 039912-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R1892 (G1)
Quality Score214
Status Not validated
Chromosome1
Chromosomal Location158245269-158356326 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 158254972 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000004133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004133] [ENSMUST00000195271]
Predicted Effect probably null
Transcript: ENSMUST00000004133
SMART Domains Protein: ENSMUSP00000004133
Gene: ENSMUSG00000004031

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
MACPF 89 281 6.58e-50 SMART
Blast:MACPF 338 362 1e-5 BLAST
EGF 457 492 6.92e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195271
SMART Domains Protein: ENSMUSP00000141709
Gene: ENSMUSG00000004031

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:MACPF 63 160 2.1e-6 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,216,338 A270T probably benign Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Adat3 T C 10: 80,606,415 L29P probably damaging Het
AI987944 A T 7: 41,374,596 C320S probably damaging Het
Asic4 C T 1: 75,469,482 R285W probably damaging Het
Asic5 A T 3: 82,020,986 I419L probably damaging Het
Batf A G 12: 85,689,328 K42E probably damaging Het
Bcar3 A G 3: 122,508,136 N160S probably benign Het
Bco2 C A 9: 50,550,563 G47V probably damaging Het
Bicc1 T G 10: 70,958,784 K181T probably damaging Het
Cacng8 A G 7: 3,415,052 D240G possibly damaging Het
Calca A G 7: 114,633,727 Y96H probably damaging Het
Cdh1 A T 8: 106,664,250 K666I possibly damaging Het
Cdh16 A T 8: 104,617,999 I500N possibly damaging Het
Chst14 A G 2: 118,927,349 Y208C probably damaging Het
Chst9 T C 18: 15,452,960 H182R probably damaging Het
Clk2 A G 3: 89,175,195 I367M possibly damaging Het
Cobl G C 11: 12,253,258 S1066W probably damaging Het
Ctcfl A G 2: 173,118,685 V35A probably benign Het
Dchs1 G T 7: 105,764,156 H1151N probably benign Het
Dennd1c T C 17: 57,067,083 T529A probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Dync1h1 A G 12: 110,646,304 Y2871C probably damaging Het
Dytn T C 1: 63,677,261 E51G probably benign Het
Esd C T 14: 74,749,673 A266V probably damaging Het
Fam104a G T 11: 113,663,386 P161H probably damaging Het
Gli1 T C 10: 127,330,106 M1093V possibly damaging Het
Gm15446 A G 5: 109,943,387 K502E probably damaging Het
Gm15448 A C 7: 3,824,574 C195G probably benign Het
Gm4076 T A 13: 85,127,328 noncoding transcript Het
Gm9830 A G 9: 44,464,528 noncoding transcript Het
Gm9938 G A 19: 23,724,591 probably benign Het
Grhl1 G A 12: 24,584,910 R245H probably damaging Het
Hnrnpul1 A T 7: 25,726,766 D553E probably benign Het
Hpn G A 7: 31,099,043 Q415* probably null Het
Hsd11b1 T G 1: 193,223,760 M175L probably benign Het
Htra1 G A 7: 130,985,069 V461I possibly damaging Het
Il1rl2 A G 1: 40,327,534 H76R probably damaging Het
Insrr G A 3: 87,813,877 V1112M probably damaging Het
Ints9 T C 14: 65,020,423 S351P probably benign Het
Itgav T A 2: 83,771,336 N350K probably damaging Het
Kdm4d C A 9: 14,464,317 V82L probably benign Het
Klc1 T C 12: 111,781,827 probably null Het
Kmt5c T A 7: 4,742,715 C69* probably null Het
Lgals3 T G 14: 47,384,707 N193K possibly damaging Het
Morc2b T A 17: 33,135,774 D1008V probably damaging Het
Mpg C T 11: 32,231,720 Q243* probably null Het
Muc15 C T 2: 110,737,352 R281* probably null Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nek5 A G 8: 22,107,729 M278T probably benign Het
Npas2 A G 1: 39,345,422 T599A probably benign Het
Nrf1 A G 6: 30,144,788 D519G probably null Het
Nup43 A G 10: 7,673,609 H176R probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr218 T C 1: 173,204,228 Y291H probably damaging Het
Olfr497 A T 7: 108,422,940 Y123F possibly damaging Het
Olfr790 A C 10: 129,501,033 I50L probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Pik3ip1 G T 11: 3,333,304 A135S probably damaging Het
Ppp4c A G 7: 126,786,280 V119A probably damaging Het
Prepl A G 17: 85,088,450 Y35H possibly damaging Het
Ptpn13 A G 5: 103,501,679 Y316C possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Ranbp2 T C 10: 58,464,099 V491A probably benign Het
Ranbp9 C A 13: 43,416,457 C495F possibly damaging Het
Rfx8 A T 1: 39,670,586 probably null Het
Rnf111 T A 9: 70,476,374 K92N probably damaging Het
Rtn1 A G 12: 72,212,563 I772T probably damaging Het
Ryr2 T A 13: 11,658,958 K72* probably null Het
Sergef A T 7: 46,614,616 probably null Het
Sez6l T C 5: 112,472,799 N305S probably damaging Het
Slc40a1 A T 1: 45,911,142 C383* probably null Het
Stab2 C T 10: 86,938,049 C806Y probably damaging Het
Stard9 A G 2: 120,693,708 T795A probably benign Het
Stk31 T C 6: 49,438,474 I536T probably damaging Het
Stox1 T A 10: 62,665,399 T461S possibly damaging Het
Suv39h2 T C 2: 3,459,768 Y219C probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Tbc1d2b T A 9: 90,218,943 I665F probably damaging Het
Tdrd6 T C 17: 43,624,805 N1784S probably benign Het
Tmem14c T C 13: 41,021,157 F81L possibly damaging Het
Tnrc6c A G 11: 117,714,362 N108D probably benign Het
Tox3 A T 8: 90,270,241 N131K probably benign Het
Tspear T A 10: 77,870,474 D359E probably benign Het
Ttc9 A G 12: 81,631,777 I125V probably benign Het
Ttn A T 2: 76,898,187 probably benign Het
Ubn2 C T 6: 38,491,291 S980F probably damaging Het
Zfp362 T A 4: 128,790,264 T30S probably benign Het
Zfp385c A C 11: 100,637,804 H32Q probably damaging Het
Zfp870 A T 17: 32,883,889 H156Q possibly damaging Het
Zfp873 T C 10: 82,061,246 C641R probably damaging Het
Zfp950 A T 19: 61,119,111 H511Q probably benign Het
Other mutations in Brinp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Brinp2 APN 1 158247100 missense probably benign 0.04
IGL01537:Brinp2 APN 1 158246809 missense probably damaging 1.00
IGL02354:Brinp2 APN 1 158247178 missense probably damaging 1.00
IGL02361:Brinp2 APN 1 158247178 missense probably damaging 1.00
R0334:Brinp2 UTSW 1 158295585 missense probably benign 0.06
R0652:Brinp2 UTSW 1 158246621 missense probably damaging 1.00
R1017:Brinp2 UTSW 1 158249451 missense probably damaging 0.99
R1141:Brinp2 UTSW 1 158247270 missense probably damaging 0.99
R1378:Brinp2 UTSW 1 158247054 missense possibly damaging 0.82
R1666:Brinp2 UTSW 1 158246558 missense probably damaging 1.00
R1986:Brinp2 UTSW 1 158246778 missense probably damaging 1.00
R3876:Brinp2 UTSW 1 158246846 missense probably damaging 0.99
R3924:Brinp2 UTSW 1 158246208 missense probably damaging 1.00
R4582:Brinp2 UTSW 1 158267938 missense probably damaging 1.00
R5239:Brinp2 UTSW 1 158251338 missense probably benign 0.00
R5537:Brinp2 UTSW 1 158255013 missense probably damaging 0.97
R5582:Brinp2 UTSW 1 158249409 missense probably damaging 1.00
R5762:Brinp2 UTSW 1 158246586 missense probably benign
R5922:Brinp2 UTSW 1 158249355 missense possibly damaging 0.79
R6746:Brinp2 UTSW 1 158266590 missense probably benign
R6999:Brinp2 UTSW 1 158251305 missense probably benign 0.20
R7144:Brinp2 UTSW 1 158295424 critical splice donor site probably null
R7221:Brinp2 UTSW 1 158266547 missense possibly damaging 0.90
R7376:Brinp2 UTSW 1 158251368 missense probably damaging 0.98
R7381:Brinp2 UTSW 1 158246343 missense probably benign 0.11
R7388:Brinp2 UTSW 1 158255009 missense probably damaging 1.00
X0024:Brinp2 UTSW 1 158267983 nonsense probably null
Z1088:Brinp2 UTSW 1 158246989 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAAGCCTGCTGTCAATTCTG -3'
(R):5'- AAGAGCAGAGAGAAATCTTCCTC -3'

Sequencing Primer
(F):5'- GACAGTTGATTTCTGATCTGTACCAC -3'
(R):5'- GCAGCAACTATGACAACCT -3'
Posted On2014-06-30