Incidental Mutation 'R1892:Hsd11b1'
ID211569
Institutional Source Beutler Lab
Gene Symbol Hsd11b1
Ensembl Gene ENSMUSG00000016194
Gene Namehydroxysteroid 11-beta dehydrogenase 1
Synonyms11beta-hydroxysteroid dehydrogenase type 1, 11beta-HSD-1
MMRRC Submission 039912-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.302) question?
Stock #R1892 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location193221634-193264075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 193223760 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 175 (M175L)
Ref Sequence ENSEMBL: ENSMUSP00000124693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016338] [ENSMUST00000159644] [ENSMUST00000160929] [ENSMUST00000161737] [ENSMUST00000192322] [ENSMUST00000194677]
Predicted Effect probably benign
Transcript: ENSMUST00000016338
AA Change: M175L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000016338
Gene: ENSMUSG00000016194
AA Change: M175L

DomainStartEndE-ValueType
Pfam:adh_short 35 230 1.1e-53 PFAM
Pfam:KR 36 215 2.4e-9 PFAM
Pfam:adh_short_C2 41 248 3.8e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159273
Predicted Effect probably benign
Transcript: ENSMUST00000159644
AA Change: M175L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124693
Gene: ENSMUSG00000016194
AA Change: M175L

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:adh_short 47 214 2.1e-32 PFAM
Pfam:KR 48 223 1.6e-10 PFAM
Pfam:adh_short_C2 53 221 4.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160929
AA Change: M145L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000123849
Gene: ENSMUSG00000016194
AA Change: M145L

DomainStartEndE-ValueType
Pfam:adh_short 5 172 1.5e-32 PFAM
Pfam:KR 6 184 8.2e-11 PFAM
Pfam:adh_short_C2 11 218 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161737
AA Change: M175L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125620
Gene: ENSMUSG00000016194
AA Change: M175L

DomainStartEndE-ValueType
Pfam:adh_short 35 202 2.6e-32 PFAM
Pfam:KR 36 216 1.7e-10 PFAM
Pfam:adh_short_C2 41 248 3.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162977
Predicted Effect probably benign
Transcript: ENSMUST00000192322
SMART Domains Protein: ENSMUSP00000141302
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 244 2.9e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194677
SMART Domains Protein: ENSMUSP00000142053
Gene: ENSMUSG00000026639

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LamNT 20 248 7.63e-84 SMART
EGF_Lam 250 310 1.67e-7 SMART
EGF_Lam 313 373 1.14e-9 SMART
EGF_Lam 376 425 5.56e-13 SMART
EGF_Lam 428 475 6.05e-14 SMART
EGF_Lam 478 528 5e-6 SMART
EGF_Lam 531 575 3.01e-9 SMART
low complexity region 662 673 N/A INTRINSIC
low complexity region 727 763 N/A INTRINSIC
coiled coil region 830 879 N/A INTRINSIC
coiled coil region 949 979 N/A INTRINSIC
coiled coil region 1037 1090 N/A INTRINSIC
low complexity region 1116 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a microsomal enzyme that catalyzes the conversion of the stress hormone cortisol to the inactive metabolite cortisone. In addition, the encoded protein can catalyze the reverse reaction, the conversion of cortisone to cortisol. Too much cortisol can lead to central obesity, and a particular variation in this gene has been associated with obesity and insulin resistance in children. Mutations in this gene and H6PD (hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase)) are the cause of cortisone reductase deficiency. Alternate splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display improved glucose tolerance and lower circulating lipid levels. Mice homozygous for a different targeted allele exhibit decreased susceptibility to weight gain, adiposis or hyperinsulinemia induced by 11-DHC. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,216,338 A270T probably benign Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Adat3 T C 10: 80,606,415 L29P probably damaging Het
AI987944 A T 7: 41,374,596 C320S probably damaging Het
Asic4 C T 1: 75,469,482 R285W probably damaging Het
Asic5 A T 3: 82,020,986 I419L probably damaging Het
Batf A G 12: 85,689,328 K42E probably damaging Het
Bcar3 A G 3: 122,508,136 N160S probably benign Het
Bco2 C A 9: 50,550,563 G47V probably damaging Het
Bicc1 T G 10: 70,958,784 K181T probably damaging Het
Brinp2 A G 1: 158,254,972 probably null Het
Cacng8 A G 7: 3,415,052 D240G possibly damaging Het
Calca A G 7: 114,633,727 Y96H probably damaging Het
Cdh1 A T 8: 106,664,250 K666I possibly damaging Het
Cdh16 A T 8: 104,617,999 I500N possibly damaging Het
Chst14 A G 2: 118,927,349 Y208C probably damaging Het
Chst9 T C 18: 15,452,960 H182R probably damaging Het
Clk2 A G 3: 89,175,195 I367M possibly damaging Het
Cobl G C 11: 12,253,258 S1066W probably damaging Het
Ctcfl A G 2: 173,118,685 V35A probably benign Het
Dchs1 G T 7: 105,764,156 H1151N probably benign Het
Dennd1c T C 17: 57,067,083 T529A probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Dync1h1 A G 12: 110,646,304 Y2871C probably damaging Het
Dytn T C 1: 63,677,261 E51G probably benign Het
Esd C T 14: 74,749,673 A266V probably damaging Het
Fam104a G T 11: 113,663,386 P161H probably damaging Het
Gli1 T C 10: 127,330,106 M1093V possibly damaging Het
Gm15446 A G 5: 109,943,387 K502E probably damaging Het
Gm15448 A C 7: 3,824,574 C195G probably benign Het
Gm4076 T A 13: 85,127,328 noncoding transcript Het
Gm9830 A G 9: 44,464,528 noncoding transcript Het
Gm9938 G A 19: 23,724,591 probably benign Het
Grhl1 G A 12: 24,584,910 R245H probably damaging Het
Hnrnpul1 A T 7: 25,726,766 D553E probably benign Het
Hpn G A 7: 31,099,043 Q415* probably null Het
Htra1 G A 7: 130,985,069 V461I possibly damaging Het
Il1rl2 A G 1: 40,327,534 H76R probably damaging Het
Insrr G A 3: 87,813,877 V1112M probably damaging Het
Ints9 T C 14: 65,020,423 S351P probably benign Het
Itgav T A 2: 83,771,336 N350K probably damaging Het
Kdm4d C A 9: 14,464,317 V82L probably benign Het
Klc1 T C 12: 111,781,827 probably null Het
Kmt5c T A 7: 4,742,715 C69* probably null Het
Lgals3 T G 14: 47,384,707 N193K possibly damaging Het
Morc2b T A 17: 33,135,774 D1008V probably damaging Het
Mpg C T 11: 32,231,720 Q243* probably null Het
Muc15 C T 2: 110,737,352 R281* probably null Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nek5 A G 8: 22,107,729 M278T probably benign Het
Npas2 A G 1: 39,345,422 T599A probably benign Het
Nrf1 A G 6: 30,144,788 D519G probably null Het
Nup43 A G 10: 7,673,609 H176R probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr218 T C 1: 173,204,228 Y291H probably damaging Het
Olfr497 A T 7: 108,422,940 Y123F possibly damaging Het
Olfr790 A C 10: 129,501,033 I50L probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Pik3ip1 G T 11: 3,333,304 A135S probably damaging Het
Ppp4c A G 7: 126,786,280 V119A probably damaging Het
Prepl A G 17: 85,088,450 Y35H possibly damaging Het
Ptpn13 A G 5: 103,501,679 Y316C possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Ranbp2 T C 10: 58,464,099 V491A probably benign Het
Ranbp9 C A 13: 43,416,457 C495F possibly damaging Het
Rfx8 A T 1: 39,670,586 probably null Het
Rnf111 T A 9: 70,476,374 K92N probably damaging Het
Rtn1 A G 12: 72,212,563 I772T probably damaging Het
Ryr2 T A 13: 11,658,958 K72* probably null Het
Sergef A T 7: 46,614,616 probably null Het
Sez6l T C 5: 112,472,799 N305S probably damaging Het
Slc40a1 A T 1: 45,911,142 C383* probably null Het
Stab2 C T 10: 86,938,049 C806Y probably damaging Het
Stard9 A G 2: 120,693,708 T795A probably benign Het
Stk31 T C 6: 49,438,474 I536T probably damaging Het
Stox1 T A 10: 62,665,399 T461S possibly damaging Het
Suv39h2 T C 2: 3,459,768 Y219C probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Tbc1d2b T A 9: 90,218,943 I665F probably damaging Het
Tdrd6 T C 17: 43,624,805 N1784S probably benign Het
Tmem14c T C 13: 41,021,157 F81L possibly damaging Het
Tnrc6c A G 11: 117,714,362 N108D probably benign Het
Tox3 A T 8: 90,270,241 N131K probably benign Het
Tspear T A 10: 77,870,474 D359E probably benign Het
Ttc9 A G 12: 81,631,777 I125V probably benign Het
Ttn A T 2: 76,898,187 probably benign Het
Ubn2 C T 6: 38,491,291 S980F probably damaging Het
Zfp362 T A 4: 128,790,264 T30S probably benign Het
Zfp385c A C 11: 100,637,804 H32Q probably damaging Het
Zfp870 A T 17: 32,883,889 H156Q possibly damaging Het
Zfp873 T C 10: 82,061,246 C641R probably damaging Het
Zfp950 A T 19: 61,119,111 H511Q probably benign Het
Other mutations in Hsd11b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Hsd11b1 APN 1 193241458 start codon destroyed probably null 0.43
IGL00969:Hsd11b1 APN 1 193223644 nonsense probably null
IGL02068:Hsd11b1 APN 1 193222046 nonsense probably null
IGL02331:Hsd11b1 APN 1 193240616 missense probably damaging 1.00
H8786:Hsd11b1 UTSW 1 193240252 missense probably benign 0.30
R0207:Hsd11b1 UTSW 1 193240248 missense probably damaging 1.00
R0267:Hsd11b1 UTSW 1 193241397 missense probably damaging 1.00
R0334:Hsd11b1 UTSW 1 193242168 intron probably benign
R0591:Hsd11b1 UTSW 1 193229676 intron probably benign
R1244:Hsd11b1 UTSW 1 193223760 missense probably benign 0.02
R1569:Hsd11b1 UTSW 1 193240327 missense probably damaging 0.99
R1570:Hsd11b1 UTSW 1 193240327 missense probably damaging 0.99
R2021:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R2022:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R2023:Hsd11b1 UTSW 1 193240378 missense probably benign 0.00
R5061:Hsd11b1 UTSW 1 193242245 missense probably benign
R5531:Hsd11b1 UTSW 1 193240249 frame shift probably null
R5768:Hsd11b1 UTSW 1 193240246 missense probably damaging 0.99
R5793:Hsd11b1 UTSW 1 193242184 missense probably damaging 1.00
R5795:Hsd11b1 UTSW 1 193240632 missense possibly damaging 0.85
R6359:Hsd11b1 UTSW 1 193242352 intron probably benign
Predicted Primers PCR Primer
(F):5'- TGGGGTCACTTATTCCAGGG -3'
(R):5'- TAGTAAGGTTTGAGCACAGCTGC -3'

Sequencing Primer
(F):5'- GGGTCACTTATTCCAGGGTCTTTTC -3'
(R):5'- TTATATCCTGATCCTCGAGCAAGCAG -3'
Posted On2014-06-30