Incidental Mutation 'R1892:Ptpn13'
ID211583
Institutional Source Beutler Lab
Gene Symbol Ptpn13
Ensembl Gene ENSMUSG00000034573
Gene Nameprotein tyrosine phosphatase, non-receptor type 13
SynonymsPTPL1, Ptpri, PTP-BL
MMRRC Submission 039912-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.181) question?
Stock #R1892 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location103425192-103598303 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103501679 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 316 (Y316C)
Ref Sequence ENSEMBL: ENSMUSP00000048119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048957] [ENSMUST00000196014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048957
AA Change: Y316C

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573
AA Change: Y316C

DomainStartEndE-ValueType
KIND 3 190 2.3e-80 SMART
Blast:B41 340 447 6e-34 BLAST
coiled coil region 460 487 N/A INTRINSIC
B41 561 774 3.3e-68 SMART
FERM_C 780 869 3.2e-35 SMART
low complexity region 1049 1058 N/A INTRINSIC
PDZ 1093 1170 7.6e-25 SMART
low complexity region 1224 1236 N/A INTRINSIC
low complexity region 1309 1322 N/A INTRINSIC
low complexity region 1331 1341 N/A INTRINSIC
PDZ 1365 1442 1.7e-24 SMART
low complexity region 1450 1468 N/A INTRINSIC
PDZ 1499 1579 3.5e-19 SMART
PDZ 1773 1845 1.2e-21 SMART
PDZ 1867 1942 1.6e-16 SMART
low complexity region 2123 2134 N/A INTRINSIC
PTPc 2179 2436 6.9e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196014
SMART Domains Protein: ENSMUSP00000143571
Gene: ENSMUSG00000034573

DomainStartEndE-ValueType
KIND 3 190 2.3e-80 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199412
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,216,338 A270T probably benign Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Adat3 T C 10: 80,606,415 L29P probably damaging Het
AI987944 A T 7: 41,374,596 C320S probably damaging Het
Asic4 C T 1: 75,469,482 R285W probably damaging Het
Asic5 A T 3: 82,020,986 I419L probably damaging Het
Batf A G 12: 85,689,328 K42E probably damaging Het
Bcar3 A G 3: 122,508,136 N160S probably benign Het
Bco2 C A 9: 50,550,563 G47V probably damaging Het
Bicc1 T G 10: 70,958,784 K181T probably damaging Het
Brinp2 A G 1: 158,254,972 probably null Het
Cacng8 A G 7: 3,415,052 D240G possibly damaging Het
Calca A G 7: 114,633,727 Y96H probably damaging Het
Cdh1 A T 8: 106,664,250 K666I possibly damaging Het
Cdh16 A T 8: 104,617,999 I500N possibly damaging Het
Chst14 A G 2: 118,927,349 Y208C probably damaging Het
Chst9 T C 18: 15,452,960 H182R probably damaging Het
Clk2 A G 3: 89,175,195 I367M possibly damaging Het
Cobl G C 11: 12,253,258 S1066W probably damaging Het
Ctcfl A G 2: 173,118,685 V35A probably benign Het
Dchs1 G T 7: 105,764,156 H1151N probably benign Het
Dennd1c T C 17: 57,067,083 T529A probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Dync1h1 A G 12: 110,646,304 Y2871C probably damaging Het
Dytn T C 1: 63,677,261 E51G probably benign Het
Esd C T 14: 74,749,673 A266V probably damaging Het
Fam104a G T 11: 113,663,386 P161H probably damaging Het
Gli1 T C 10: 127,330,106 M1093V possibly damaging Het
Gm15446 A G 5: 109,943,387 K502E probably damaging Het
Gm15448 A C 7: 3,824,574 C195G probably benign Het
Gm4076 T A 13: 85,127,328 noncoding transcript Het
Gm9830 A G 9: 44,464,528 noncoding transcript Het
Gm9938 G A 19: 23,724,591 probably benign Het
Grhl1 G A 12: 24,584,910 R245H probably damaging Het
Hnrnpul1 A T 7: 25,726,766 D553E probably benign Het
Hpn G A 7: 31,099,043 Q415* probably null Het
Hsd11b1 T G 1: 193,223,760 M175L probably benign Het
Htra1 G A 7: 130,985,069 V461I possibly damaging Het
Il1rl2 A G 1: 40,327,534 H76R probably damaging Het
Insrr G A 3: 87,813,877 V1112M probably damaging Het
Ints9 T C 14: 65,020,423 S351P probably benign Het
Itgav T A 2: 83,771,336 N350K probably damaging Het
Kdm4d C A 9: 14,464,317 V82L probably benign Het
Klc1 T C 12: 111,781,827 probably null Het
Kmt5c T A 7: 4,742,715 C69* probably null Het
Lgals3 T G 14: 47,384,707 N193K possibly damaging Het
Morc2b T A 17: 33,135,774 D1008V probably damaging Het
Mpg C T 11: 32,231,720 Q243* probably null Het
Muc15 C T 2: 110,737,352 R281* probably null Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nek5 A G 8: 22,107,729 M278T probably benign Het
Npas2 A G 1: 39,345,422 T599A probably benign Het
Nrf1 A G 6: 30,144,788 D519G probably null Het
Nup43 A G 10: 7,673,609 H176R probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr218 T C 1: 173,204,228 Y291H probably damaging Het
Olfr497 A T 7: 108,422,940 Y123F possibly damaging Het
Olfr790 A C 10: 129,501,033 I50L probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Pik3ip1 G T 11: 3,333,304 A135S probably damaging Het
Ppp4c A G 7: 126,786,280 V119A probably damaging Het
Prepl A G 17: 85,088,450 Y35H possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Ranbp2 T C 10: 58,464,099 V491A probably benign Het
Ranbp9 C A 13: 43,416,457 C495F possibly damaging Het
Rfx8 A T 1: 39,670,586 probably null Het
Rnf111 T A 9: 70,476,374 K92N probably damaging Het
Rtn1 A G 12: 72,212,563 I772T probably damaging Het
Ryr2 T A 13: 11,658,958 K72* probably null Het
Sergef A T 7: 46,614,616 probably null Het
Sez6l T C 5: 112,472,799 N305S probably damaging Het
Slc40a1 A T 1: 45,911,142 C383* probably null Het
Stab2 C T 10: 86,938,049 C806Y probably damaging Het
Stard9 A G 2: 120,693,708 T795A probably benign Het
Stk31 T C 6: 49,438,474 I536T probably damaging Het
Stox1 T A 10: 62,665,399 T461S possibly damaging Het
Suv39h2 T C 2: 3,459,768 Y219C probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Tbc1d2b T A 9: 90,218,943 I665F probably damaging Het
Tdrd6 T C 17: 43,624,805 N1784S probably benign Het
Tmem14c T C 13: 41,021,157 F81L possibly damaging Het
Tnrc6c A G 11: 117,714,362 N108D probably benign Het
Tox3 A T 8: 90,270,241 N131K probably benign Het
Tspear T A 10: 77,870,474 D359E probably benign Het
Ttc9 A G 12: 81,631,777 I125V probably benign Het
Ttn A T 2: 76,898,187 probably benign Het
Ubn2 C T 6: 38,491,291 S980F probably damaging Het
Zfp362 T A 4: 128,790,264 T30S probably benign Het
Zfp385c A C 11: 100,637,804 H32Q probably damaging Het
Zfp870 A T 17: 32,883,889 H156Q possibly damaging Het
Zfp873 T C 10: 82,061,246 C641R probably damaging Het
Zfp950 A T 19: 61,119,111 H511Q probably benign Het
Other mutations in Ptpn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptpn13 APN 5 103551058 missense probably damaging 1.00
IGL00569:Ptpn13 APN 5 103591006 splice site probably benign
IGL00764:Ptpn13 APN 5 103597718 missense probably damaging 1.00
IGL00805:Ptpn13 APN 5 103554729 missense probably benign 0.33
IGL00922:Ptpn13 APN 5 103588088 missense probably damaging 1.00
IGL00959:Ptpn13 APN 5 103517571 critical splice donor site probably null
IGL01090:Ptpn13 APN 5 103541314 missense probably null 0.80
IGL01352:Ptpn13 APN 5 103486775 splice site probably null
IGL01510:Ptpn13 APN 5 103562300 missense probably damaging 1.00
IGL01515:Ptpn13 APN 5 103556113 missense probably benign 0.06
IGL01896:Ptpn13 APN 5 103501523 missense possibly damaging 0.78
IGL02094:Ptpn13 APN 5 103594617 missense probably damaging 1.00
IGL02561:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02562:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02567:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02604:Ptpn13 APN 5 103501903 missense probably benign 0.01
IGL02679:Ptpn13 APN 5 103569454 missense possibly damaging 0.55
IGL02981:Ptpn13 APN 5 103528804 missense probably damaging 1.00
IGL03131:Ptpn13 APN 5 103517559 missense probably benign
IGL03136:Ptpn13 APN 5 103543463 missense possibly damaging 0.49
IGL03163:Ptpn13 APN 5 103591346 missense probably damaging 1.00
IGL03271:Ptpn13 APN 5 103462148 missense probably damaging 1.00
IGL03297:Ptpn13 APN 5 103541077 missense probably benign 0.13
IGL03328:Ptpn13 APN 5 103516348 missense probably benign 0.00
IGL03343:Ptpn13 APN 5 103554950 missense possibly damaging 0.88
IGL02835:Ptpn13 UTSW 5 103560025 missense probably damaging 0.98
P0021:Ptpn13 UTSW 5 103528820 missense probably benign 0.39
R0017:Ptpn13 UTSW 5 103486772 critical splice donor site probably null
R0090:Ptpn13 UTSW 5 103569503 missense probably damaging 1.00
R0111:Ptpn13 UTSW 5 103580763 splice site probably benign
R0183:Ptpn13 UTSW 5 103516408 missense probably benign 0.00
R0230:Ptpn13 UTSW 5 103527131 missense probably damaging 1.00
R0302:Ptpn13 UTSW 5 103565225 missense probably benign
R0360:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0364:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0388:Ptpn13 UTSW 5 103555062 missense probably benign 0.31
R0504:Ptpn13 UTSW 5 103501496 missense possibly damaging 0.92
R0558:Ptpn13 UTSW 5 103529717 missense probably damaging 0.99
R0562:Ptpn13 UTSW 5 103516425 critical splice donor site probably null
R0568:Ptpn13 UTSW 5 103489765 missense probably damaging 1.00
R0609:Ptpn13 UTSW 5 103556145 missense probably benign
R0669:Ptpn13 UTSW 5 103556109 missense probably benign
R0739:Ptpn13 UTSW 5 103575132 missense probably benign
R1006:Ptpn13 UTSW 5 103586789 missense probably benign 0.04
R1164:Ptpn13 UTSW 5 103489773 missense probably damaging 1.00
R1274:Ptpn13 UTSW 5 103550260 missense probably damaging 0.98
R1501:Ptpn13 UTSW 5 103516364 missense probably benign 0.01
R1529:Ptpn13 UTSW 5 103564132 missense probably benign 0.00
R1533:Ptpn13 UTSW 5 103556178 nonsense probably null
R1613:Ptpn13 UTSW 5 103536871 missense possibly damaging 0.89
R1616:Ptpn13 UTSW 5 103565237 missense possibly damaging 0.49
R1830:Ptpn13 UTSW 5 103543459 missense probably benign 0.00
R1907:Ptpn13 UTSW 5 103580709 missense probably null 0.45
R2143:Ptpn13 UTSW 5 103556133 missense probably benign
R2145:Ptpn13 UTSW 5 103556133 missense probably benign
R2151:Ptpn13 UTSW 5 103525785 missense probably damaging 1.00
R2180:Ptpn13 UTSW 5 103569558 missense probably damaging 1.00
R2264:Ptpn13 UTSW 5 103489661 missense possibly damaging 0.96
R2313:Ptpn13 UTSW 5 103564161 missense probably damaging 1.00
R3522:Ptpn13 UTSW 5 103589854 splice site probably benign
R3773:Ptpn13 UTSW 5 103477121 missense probably damaging 1.00
R3924:Ptpn13 UTSW 5 103550741 splice site probably benign
R4289:Ptpn13 UTSW 5 103533285 missense probably damaging 1.00
R4348:Ptpn13 UTSW 5 103569726 missense probably damaging 1.00
R4385:Ptpn13 UTSW 5 103533407 splice site probably null
R4526:Ptpn13 UTSW 5 103501469 missense probably benign 0.32
R4557:Ptpn13 UTSW 5 103541110 missense probably damaging 1.00
R4596:Ptpn13 UTSW 5 103523692 missense probably benign 0.06
R4632:Ptpn13 UTSW 5 103569860 missense possibly damaging 0.46
R4727:Ptpn13 UTSW 5 103569855 missense probably benign
R4780:Ptpn13 UTSW 5 103586773 missense probably benign 0.04
R4793:Ptpn13 UTSW 5 103582778 critical splice donor site probably null
R4812:Ptpn13 UTSW 5 103523615 missense probably benign 0.00
R4939:Ptpn13 UTSW 5 103517469 intron probably null
R4951:Ptpn13 UTSW 5 103588046 missense probably benign 0.00
R5052:Ptpn13 UTSW 5 103561980 missense probably damaging 1.00
R5148:Ptpn13 UTSW 5 103492232 missense probably damaging 1.00
R5309:Ptpn13 UTSW 5 103541053 missense probably damaging 1.00
R5521:Ptpn13 UTSW 5 103501428 missense probably benign 0.03
R5545:Ptpn13 UTSW 5 103561964 missense probably damaging 1.00
R5696:Ptpn13 UTSW 5 103554759 missense probably benign 0.20
R5735:Ptpn13 UTSW 5 103554820 missense probably benign 0.03
R5815:Ptpn13 UTSW 5 103597690 splice site probably null
R5876:Ptpn13 UTSW 5 103476960 missense probably damaging 1.00
R5878:Ptpn13 UTSW 5 103477118 missense possibly damaging 0.89
R6366:Ptpn13 UTSW 5 103551053 missense probably damaging 1.00
R6455:Ptpn13 UTSW 5 103541284 missense probably benign 0.00
R6492:Ptpn13 UTSW 5 103501612 missense probably benign 0.02
R6709:Ptpn13 UTSW 5 103586756 missense probably benign 0.18
R6759:Ptpn13 UTSW 5 103565255 missense possibly damaging 0.49
R6944:Ptpn13 UTSW 5 103476991 missense probably null 1.00
R7079:Ptpn13 UTSW 5 103501886 missense probably benign 0.00
R7253:Ptpn13 UTSW 5 103565284 missense possibly damaging 0.68
R7254:Ptpn13 UTSW 5 103594636 missense probably damaging 1.00
R7391:Ptpn13 UTSW 5 103540981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCATCAGAGACACACGAG -3'
(R):5'- TCGAATTCGGTCCAAAGCGC -3'

Sequencing Primer
(F):5'- CACACGAGATGAGGAAGACTATCTC -3'
(R):5'- GAATTCGGTCCAAAGCGCTTGATAC -3'
Posted On2014-06-30