Incidental Mutation 'R1892:Cdh16'
ID211606
Institutional Source Beutler Lab
Gene Symbol Cdh16
Ensembl Gene ENSMUSG00000031881
Gene Namecadherin 16
SynonymsKSP-cadherin
MMRRC Submission 039912-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R1892 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location104601911-104624396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104617999 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 500 (I500N)
Ref Sequence ENSEMBL: ENSMUSP00000148478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163783] [ENSMUST00000211849] [ENSMUST00000211903] [ENSMUST00000212045] [ENSMUST00000212324] [ENSMUST00000212420] [ENSMUST00000212447] [ENSMUST00000212662] [ENSMUST00000212748] [ENSMUST00000212882] [ENSMUST00000213033]
Predicted Effect possibly damaging
Transcript: ENSMUST00000163783
AA Change: I470N

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129663
Gene: ENSMUSG00000031881
AA Change: I470N

DomainStartEndE-ValueType
CA 47 126 2.42e-9 SMART
CA 150 243 3.93e-9 SMART
CA 260 336 5.52e-13 SMART
CA 360 449 1.33e-15 SMART
CA 474 563 3.35e-1 SMART
CA 585 663 7.88e-1 SMART
transmembrane domain 788 810 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211849
Predicted Effect probably benign
Transcript: ENSMUST00000211889
Predicted Effect possibly damaging
Transcript: ENSMUST00000211903
AA Change: I500N

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000212045
Predicted Effect probably benign
Transcript: ENSMUST00000212318
Predicted Effect probably benign
Transcript: ENSMUST00000212324
Predicted Effect possibly damaging
Transcript: ENSMUST00000212420
AA Change: I41N

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000212447
Predicted Effect probably benign
Transcript: ENSMUST00000212662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212689
Predicted Effect probably benign
Transcript: ENSMUST00000212748
Predicted Effect possibly damaging
Transcript: ENSMUST00000212882
AA Change: I500N

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000213033
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, genes encoding calcium-dependent, membrane-associated glycoproteins. Mapped to a previously identified cluster of cadherin genes on chromosome 16q22.1, the gene localizes with superfamily members CDH1, CDH3, CDH5, CDH8 and CDH11. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 G A 7: 120,216,338 A270T probably benign Het
Abcb7 A T X: 104,342,536 H97Q probably damaging Het
Adat3 T C 10: 80,606,415 L29P probably damaging Het
AI987944 A T 7: 41,374,596 C320S probably damaging Het
Asic4 C T 1: 75,469,482 R285W probably damaging Het
Asic5 A T 3: 82,020,986 I419L probably damaging Het
Batf A G 12: 85,689,328 K42E probably damaging Het
Bcar3 A G 3: 122,508,136 N160S probably benign Het
Bco2 C A 9: 50,550,563 G47V probably damaging Het
Bicc1 T G 10: 70,958,784 K181T probably damaging Het
Brinp2 A G 1: 158,254,972 probably null Het
Cacng8 A G 7: 3,415,052 D240G possibly damaging Het
Calca A G 7: 114,633,727 Y96H probably damaging Het
Cdh1 A T 8: 106,664,250 K666I possibly damaging Het
Chst14 A G 2: 118,927,349 Y208C probably damaging Het
Chst9 T C 18: 15,452,960 H182R probably damaging Het
Clk2 A G 3: 89,175,195 I367M possibly damaging Het
Cobl G C 11: 12,253,258 S1066W probably damaging Het
Ctcfl A G 2: 173,118,685 V35A probably benign Het
Dchs1 G T 7: 105,764,156 H1151N probably benign Het
Dennd1c T C 17: 57,067,083 T529A probably benign Het
Dnah11 A T 12: 118,106,474 V1532D possibly damaging Het
Dync1h1 A G 12: 110,646,304 Y2871C probably damaging Het
Dytn T C 1: 63,677,261 E51G probably benign Het
Esd C T 14: 74,749,673 A266V probably damaging Het
Fam104a G T 11: 113,663,386 P161H probably damaging Het
Gli1 T C 10: 127,330,106 M1093V possibly damaging Het
Gm15446 A G 5: 109,943,387 K502E probably damaging Het
Gm15448 A C 7: 3,824,574 C195G probably benign Het
Gm4076 T A 13: 85,127,328 noncoding transcript Het
Gm9830 A G 9: 44,464,528 noncoding transcript Het
Gm9938 G A 19: 23,724,591 probably benign Het
Grhl1 G A 12: 24,584,910 R245H probably damaging Het
Hnrnpul1 A T 7: 25,726,766 D553E probably benign Het
Hpn G A 7: 31,099,043 Q415* probably null Het
Hsd11b1 T G 1: 193,223,760 M175L probably benign Het
Htra1 G A 7: 130,985,069 V461I possibly damaging Het
Il1rl2 A G 1: 40,327,534 H76R probably damaging Het
Insrr G A 3: 87,813,877 V1112M probably damaging Het
Ints9 T C 14: 65,020,423 S351P probably benign Het
Itgav T A 2: 83,771,336 N350K probably damaging Het
Kdm4d C A 9: 14,464,317 V82L probably benign Het
Klc1 T C 12: 111,781,827 probably null Het
Kmt5c T A 7: 4,742,715 C69* probably null Het
Lgals3 T G 14: 47,384,707 N193K possibly damaging Het
Morc2b T A 17: 33,135,774 D1008V probably damaging Het
Mpg C T 11: 32,231,720 Q243* probably null Het
Muc15 C T 2: 110,737,352 R281* probably null Het
Ncstn CAGCTCCACGAAG CAG 1: 172,071,471 probably null Het
Nek5 A G 8: 22,107,729 M278T probably benign Het
Npas2 A G 1: 39,345,422 T599A probably benign Het
Nrf1 A G 6: 30,144,788 D519G probably null Het
Nup43 A G 10: 7,673,609 H176R probably damaging Het
Nxpe2 T C 9: 48,326,614 T114A probably damaging Het
Olfr218 T C 1: 173,204,228 Y291H probably damaging Het
Olfr497 A T 7: 108,422,940 Y123F possibly damaging Het
Olfr790 A C 10: 129,501,033 I50L probably benign Het
Perm1 C T 4: 156,217,883 R295C probably benign Het
Pik3ip1 G T 11: 3,333,304 A135S probably damaging Het
Ppp4c A G 7: 126,786,280 V119A probably damaging Het
Prepl A G 17: 85,088,450 Y35H possibly damaging Het
Ptpn13 A G 5: 103,501,679 Y316C possibly damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Ranbp2 T C 10: 58,464,099 V491A probably benign Het
Ranbp9 C A 13: 43,416,457 C495F possibly damaging Het
Rfx8 A T 1: 39,670,586 probably null Het
Rnf111 T A 9: 70,476,374 K92N probably damaging Het
Rtn1 A G 12: 72,212,563 I772T probably damaging Het
Ryr2 T A 13: 11,658,958 K72* probably null Het
Sergef A T 7: 46,614,616 probably null Het
Sez6l T C 5: 112,472,799 N305S probably damaging Het
Slc40a1 A T 1: 45,911,142 C383* probably null Het
Stab2 C T 10: 86,938,049 C806Y probably damaging Het
Stard9 A G 2: 120,693,708 T795A probably benign Het
Stk31 T C 6: 49,438,474 I536T probably damaging Het
Stox1 T A 10: 62,665,399 T461S possibly damaging Het
Suv39h2 T C 2: 3,459,768 Y219C probably damaging Het
Tap1 T G 17: 34,194,941 D643E probably damaging Het
Tbc1d2b T A 9: 90,218,943 I665F probably damaging Het
Tdrd6 T C 17: 43,624,805 N1784S probably benign Het
Tmem14c T C 13: 41,021,157 F81L possibly damaging Het
Tnrc6c A G 11: 117,714,362 N108D probably benign Het
Tox3 A T 8: 90,270,241 N131K probably benign Het
Tspear T A 10: 77,870,474 D359E probably benign Het
Ttc9 A G 12: 81,631,777 I125V probably benign Het
Ttn A T 2: 76,898,187 probably benign Het
Ubn2 C T 6: 38,491,291 S980F probably damaging Het
Zfp362 T A 4: 128,790,264 T30S probably benign Het
Zfp385c A C 11: 100,637,804 H32Q probably damaging Het
Zfp870 A T 17: 32,883,889 H156Q possibly damaging Het
Zfp873 T C 10: 82,061,246 C641R probably damaging Het
Zfp950 A T 19: 61,119,111 H511Q probably benign Het
Other mutations in Cdh16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Cdh16 APN 8 104623413 missense probably benign 0.00
IGL01406:Cdh16 APN 8 104618412 missense possibly damaging 0.93
IGL01477:Cdh16 APN 8 104618508 missense probably damaging 0.97
IGL01478:Cdh16 APN 8 104614488 splice site probably benign
IGL01783:Cdh16 APN 8 104617856 missense probably damaging 1.00
IGL01951:Cdh16 APN 8 104617691 missense probably damaging 0.99
IGL02390:Cdh16 APN 8 104621974 missense probably damaging 1.00
IGL02646:Cdh16 APN 8 104622105 critical splice acceptor site probably null
IGL02938:Cdh16 APN 8 104616929 intron probably benign
IGL02961:Cdh16 APN 8 104615205 missense probably damaging 1.00
IGL03378:Cdh16 APN 8 104619285 missense probably benign 0.09
PIT1430001:Cdh16 UTSW 8 104617639 missense probably benign 0.05
R0016:Cdh16 UTSW 8 104617632 missense probably benign 0.22
R1233:Cdh16 UTSW 8 104618482 missense possibly damaging 0.89
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1470:Cdh16 UTSW 8 104618371 missense probably benign 0.04
R1490:Cdh16 UTSW 8 104622070 missense probably damaging 1.00
R1752:Cdh16 UTSW 8 104619873 critical splice donor site probably null
R1913:Cdh16 UTSW 8 104616468 missense probably benign 0.11
R1933:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R1934:Cdh16 UTSW 8 104617963 missense possibly damaging 0.71
R2029:Cdh16 UTSW 8 104617802 missense probably damaging 1.00
R2057:Cdh16 UTSW 8 104621965 nonsense probably null
R2337:Cdh16 UTSW 8 104622270 missense probably benign 0.09
R3848:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3850:Cdh16 UTSW 8 104617841 missense possibly damaging 0.64
R3892:Cdh16 UTSW 8 104616327 missense probably damaging 1.00
R4167:Cdh16 UTSW 8 104617730 missense probably benign 0.02
R4577:Cdh16 UTSW 8 104618559 missense probably damaging 1.00
R4657:Cdh16 UTSW 8 104615226 unclassified probably null
R4726:Cdh16 UTSW 8 104616032 missense probably damaging 0.97
R4843:Cdh16 UTSW 8 104621540 missense probably damaging 1.00
R4878:Cdh16 UTSW 8 104618064 missense probably damaging 1.00
R5013:Cdh16 UTSW 8 104617028 missense probably damaging 1.00
R5642:Cdh16 UTSW 8 104618045 missense probably damaging 0.98
R6134:Cdh16 UTSW 8 104616065 missense probably benign 0.15
R6311:Cdh16 UTSW 8 104614433 missense probably benign 0.40
R6352:Cdh16 UTSW 8 104616992 missense probably damaging 0.99
R6382:Cdh16 UTSW 8 104621543 missense possibly damaging 0.78
R6713:Cdh16 UTSW 8 104619985 nonsense probably null
R6732:Cdh16 UTSW 8 104618533 missense probably benign 0.28
R6755:Cdh16 UTSW 8 104619248 missense probably damaging 1.00
R6913:Cdh16 UTSW 8 104622264 missense probably benign 0.00
R7037:Cdh16 UTSW 8 104617635 nonsense probably null
R7202:Cdh16 UTSW 8 104614148 missense unknown
R7413:Cdh16 UTSW 8 104619940 missense probably benign 0.00
R7460:Cdh16 UTSW 8 104622291 missense possibly damaging 0.88
X0067:Cdh16 UTSW 8 104620017 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCACCTTGTGATCAGGAGC -3'
(R):5'- CCCTGAGTTCATCAATTCCCAGG -3'

Sequencing Primer
(F):5'- TGATCAGGAGCTGCCTCATAG -3'
(R):5'- CTGAGTTCATCAATTCCCAGGTAAGC -3'
Posted On2014-06-30