Incidental Mutation 'R0123:Zfp108'
ID21163
Institutional Source Beutler Lab
Gene Symbol Zfp108
Ensembl Gene ENSMUSG00000030486
Gene Namezinc finger protein 108
Synonyms
MMRRC Submission 038408-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0123 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location24254794-24262445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24260467 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 161 (H161R)
Ref Sequence ENSEMBL: ENSMUSP00000145928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072713] [ENSMUST00000205982] [ENSMUST00000206777]
Predicted Effect probably benign
Transcript: ENSMUST00000072713
AA Change: H161R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072496
Gene: ENSMUSG00000030486
AA Change: H161R

DomainStartEndE-ValueType
KRAB 8 63 7.94e-18 SMART
low complexity region 140 153 N/A INTRINSIC
ZnF_C2H2 281 303 1.33e-1 SMART
ZnF_C2H2 309 331 1.69e-3 SMART
ZnF_C2H2 337 359 1.3e-4 SMART
ZnF_C2H2 365 387 2.71e-2 SMART
ZnF_C2H2 393 415 5.14e-3 SMART
ZnF_C2H2 421 443 1.87e-5 SMART
ZnF_C2H2 449 471 3.44e-4 SMART
ZnF_C2H2 477 497 1.08e1 SMART
ZnF_C2H2 503 525 3.89e-3 SMART
ZnF_C2H2 531 553 2.09e-3 SMART
ZnF_C2H2 559 581 4.61e-5 SMART
ZnF_C2H2 587 609 7.9e-4 SMART
ZnF_C2H2 615 637 1.67e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205982
AA Change: H161R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206777
AA Change: H161R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1276 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,201 probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Becn1 A G 11: 101,290,498 Y326H probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1g T A 11: 94,409,476 H2156L probably damaging Het
Cd22 A G 7: 30,867,108 probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Cmya5 A G 13: 93,095,904 L892P possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Cts8 T A 13: 61,253,577 M75L probably benign Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dlg5 T C 14: 24,147,206 M1558V probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Ell2 T C 13: 75,762,140 probably benign Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Nrxn1 A T 17: 90,995,487 probably null Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Upk1a A T 7: 30,612,394 I25N possibly damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp982 A T 4: 147,512,636 K150I probably benign Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zswim8 T C 14: 20,716,490 probably benign Het
Other mutations in Zfp108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Zfp108 APN 7 24261486 missense possibly damaging 0.82
IGL01392:Zfp108 APN 7 24258447 splice site probably benign
R0126:Zfp108 UTSW 7 24260724 missense probably benign 0.01
R0134:Zfp108 UTSW 7 24260467 missense probably benign 0.00
R0243:Zfp108 UTSW 7 24261783 missense possibly damaging 0.81
R1227:Zfp108 UTSW 7 24260460 missense probably benign 0.00
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1464:Zfp108 UTSW 7 24260548 missense probably benign 0.00
R1731:Zfp108 UTSW 7 24258539 missense possibly damaging 0.75
R1739:Zfp108 UTSW 7 24261310 missense probably damaging 1.00
R1751:Zfp108 UTSW 7 24261896 missense probably damaging 1.00
R3713:Zfp108 UTSW 7 24261845 nonsense probably null
R3839:Zfp108 UTSW 7 24260556 missense probably benign 0.01
R3919:Zfp108 UTSW 7 24260832 missense probably damaging 0.99
R3922:Zfp108 UTSW 7 24261348 missense probably damaging 1.00
R4707:Zfp108 UTSW 7 24260412 missense probably benign 0.08
R4912:Zfp108 UTSW 7 24261314 missense probably damaging 1.00
R4965:Zfp108 UTSW 7 24260148 missense probably benign
R4989:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5014:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5163:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5183:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5184:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5185:Zfp108 UTSW 7 24260738 missense probably benign 0.00
R5453:Zfp108 UTSW 7 24261264 missense probably damaging 1.00
R5600:Zfp108 UTSW 7 24260586 missense probably benign 0.00
R6494:Zfp108 UTSW 7 24261357 missense probably damaging 1.00
R6601:Zfp108 UTSW 7 24261394 missense probably damaging 0.98
R6735:Zfp108 UTSW 7 24261772 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAACTTAGCCCTTCAATGTCCCC -3'
(R):5'- AAGACTTCTTGGCCCTTGCTGC -3'

Sequencing Primer
(F):5'- TATATTCCCTTCAGGAGGCCAGAG -3'
(R):5'- TGTGTAATCACAATCCTGGGTGAG -3'
Posted On2013-04-11