Incidental Mutation 'R0123:Abraxas2'
ID21169
Institutional Source Beutler Lab
Gene Symbol Abraxas2
Ensembl Gene ENSMUSG00000030965
Gene NameBRISC complex subunit
SynonymsC430003P19Rik, Fam175b, KIAA0157
MMRRC Submission 038408-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0123 (G1)
Quality Score225
Status Validated (trace)
Chromosome7
Chromosomal Location132859225-132885111 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132874855 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 105 (R105Q)
Ref Sequence ENSEMBL: ENSMUSP00000101767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084497] [ENSMUST00000106161] [ENSMUST00000124096] [ENSMUST00000134784]
Predicted Effect probably damaging
Transcript: ENSMUST00000084497
AA Change: R108Q

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000081541
Gene: ENSMUSG00000030965
AA Change: R108Q

DomainStartEndE-ValueType
coiled coil region 224 276 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106161
AA Change: R105Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101767
Gene: ENSMUSG00000030965
AA Change: R105Q

DomainStartEndE-ValueType
coiled coil region 221 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129552
AA Change: R103Q

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect silent
Transcript: ENSMUST00000134784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144225
Predicted Effect probably benign
Transcript: ENSMUST00000147786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211184
Meta Mutation Damage Score 0.028 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,201 probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Becn1 A G 11: 101,290,498 Y326H probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1g T A 11: 94,409,476 H2156L probably damaging Het
Cd22 A G 7: 30,867,108 probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Cmya5 A G 13: 93,095,904 L892P possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Cts8 T A 13: 61,253,577 M75L probably benign Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dlg5 T C 14: 24,147,206 M1558V probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Ell2 T C 13: 75,762,140 probably benign Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Hira T A 16: 18,956,171 F949I probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Nrxn1 A T 17: 90,995,487 probably null Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Upk1a A T 7: 30,612,394 I25N possibly damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp982 A T 4: 147,512,636 K150I probably benign Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zswim8 T C 14: 20,716,490 probably benign Het
Other mutations in Abraxas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Abraxas2 APN 7 132883428 missense probably benign 0.00
R0225:Abraxas2 UTSW 7 132874855 missense probably damaging 1.00
R0670:Abraxas2 UTSW 7 132869031 critical splice acceptor site probably null
R2145:Abraxas2 UTSW 7 132883061 missense probably benign 0.27
R2244:Abraxas2 UTSW 7 132883211 missense probably benign 0.00
R3839:Abraxas2 UTSW 7 132883138 missense probably benign 0.03
R5133:Abraxas2 UTSW 7 132883146 missense probably benign 0.01
R5260:Abraxas2 UTSW 7 132859274 missense probably damaging 1.00
R6217:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6305:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6312:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6313:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6793:Abraxas2 UTSW 7 132874834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ccttaccagccctgCATACTTGATTT -3'
(R):5'- CCTGCGGTTTGGTCTAAAGAGAACATA -3'

Sequencing Primer
(F):5'- catctattttccacaccctacaac -3'
(R):5'- GCATGAGTAGAATTGTTGGCGG -3'
Posted On2013-04-11