Incidental Mutation 'R1894:Mybbp1a'
ID211826
Institutional Source Beutler Lab
Gene Symbol Mybbp1a
Ensembl Gene ENSMUSG00000040463
Gene NameMYB binding protein (P160) 1a
Synonymsp160MBP, p67MBP
MMRRC Submission 039914-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1894 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72441355-72451768 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72446037 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 565 (T565I)
Ref Sequence ENSEMBL: ENSMUSP00000044827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045633]
Predicted Effect probably benign
Transcript: ENSMUST00000045633
AA Change: T565I

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000044827
Gene: ENSMUSG00000040463
AA Change: T565I

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
Pfam:DNA_pol_phi 70 835 1.2e-194 PFAM
low complexity region 839 852 N/A INTRINSIC
low complexity region 1080 1090 N/A INTRINSIC
low complexity region 1109 1122 N/A INTRINSIC
low complexity region 1259 1269 N/A INTRINSIC
low complexity region 1314 1329 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144923
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156833
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162048
Meta Mutation Damage Score 0.0376 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar transcriptional regulator that was first identified by its ability to bind specifically to the Myb proto-oncogene protein. The encoded protein is thought to play a role in many cellular processes including response to nucleolar stress, tumor suppression and synthesis of ribosomal DNA. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality before blastocyst formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,664,576 I157F probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Ago4 A G 4: 126,512,600 Y306H probably benign Het
Cblc T C 7: 19,792,577 T196A probably damaging Het
Ccdc109b T C 3: 129,934,663 H55R probably benign Het
Cfap52 T A 11: 67,953,619 probably null Het
Cops3 T C 11: 59,820,018 N375S probably benign Het
Crb1 T C 1: 139,243,193 T759A probably benign Het
Dnah3 T C 7: 120,086,334 K153E probably benign Het
Elovl1 C T 4: 118,430,748 S27F probably damaging Het
Erc2 A G 14: 28,141,228 E804G probably damaging Het
Fam110b G T 4: 5,798,840 C86F probably damaging Het
Fbn1 T A 2: 125,394,621 R380W probably damaging Het
Gatad2a C T 8: 69,916,651 R221Q probably damaging Het
Gcn1l1 C T 5: 115,589,115 P677L probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Gm9817 T C 13: 45,079,129 V136A unknown Het
Gmip T A 8: 69,820,972 L971H probably damaging Het
Gnptab G A 10: 88,419,127 E192K possibly damaging Het
Grm7 G A 6: 111,358,607 V660I probably benign Het
Helz2 G A 2: 181,234,289 P1471S probably damaging Het
Herc1 G A 9: 66,479,461 G3786S probably damaging Het
Isg20 T C 7: 78,919,899 V206A probably benign Het
Jund T A 8: 70,699,821 I255N probably damaging Het
Kcnt2 A T 1: 140,425,341 I263F probably damaging Het
Kif2c A T 4: 117,162,223 L561Q probably benign Het
Klhl3 T C 13: 58,009,375 D546G probably damaging Het
Klk1b4 A T 7: 44,209,630 Q24L probably benign Het
Ltbp2 A T 12: 84,787,961 C225S probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Med18 G A 4: 132,459,931 R86* probably null Het
Mfsd2b T C 12: 4,869,155 E63G probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Nfrkb T A 9: 31,414,768 V1169E probably benign Het
Nr2f2 T A 7: 70,354,671 M411L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nup214 A T 2: 31,996,380 T585S possibly damaging Het
Olfr1025-ps1 C T 2: 85,918,255 T110I probably benign Het
Olfr807 A T 10: 129,755,074 C125* probably null Het
Olfr873 T C 9: 20,300,337 S47P probably benign Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pih1d1 T A 7: 45,157,741 I166N probably damaging Het
Prl2c5 T C 13: 13,191,678 F181L probably benign Het
Prx C T 7: 27,519,110 T1012I possibly damaging Het
Rassf8 T A 6: 145,808,473 V5E probably damaging Het
Rassf9 C A 10: 102,544,894 R44S possibly damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Sec16b T A 1: 157,552,975 M372K possibly damaging Het
Sgcd A T 11: 47,195,110 I71N probably damaging Het
Slco5a1 C T 1: 12,872,259 C721Y probably damaging Het
Slx4ip A T 2: 137,068,118 K344N probably benign Het
Sorcs3 A T 19: 48,794,274 Q1076L probably benign Het
Spata21 A T 4: 141,111,381 N581I possibly damaging Het
Spata31d1d G T 13: 59,728,122 P533H probably benign Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Tex14 T G 11: 87,474,448 F61V probably damaging Het
Timp3 C T 10: 86,345,852 R196* probably null Het
Tll2 A G 19: 41,088,671 probably null Het
Tppp A G 13: 74,021,207 D22G possibly damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Uaca T C 9: 60,870,436 S702P possibly damaging Het
Uggt2 T C 14: 119,049,718 E146G probably damaging Het
Vmn1r233 T C 17: 20,993,732 S319G probably benign Het
Wdr47 A T 3: 108,623,376 Q395L possibly damaging Het
Wrnip1 A G 13: 32,805,336 probably null Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Other mutations in Mybbp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Mybbp1a APN 11 72443567 missense probably damaging 1.00
IGL03240:Mybbp1a APN 11 72445666 missense possibly damaging 0.95
IGL03271:Mybbp1a APN 11 72443918 splice site probably benign
IGL03344:Mybbp1a APN 11 72445202 missense probably damaging 1.00
R0276:Mybbp1a UTSW 11 72450107 unclassified probably null
R0437:Mybbp1a UTSW 11 72448848 missense possibly damaging 0.75
R0551:Mybbp1a UTSW 11 72448376 missense probably benign 0.06
R1394:Mybbp1a UTSW 11 72443648 missense probably damaging 1.00
R1667:Mybbp1a UTSW 11 72445217 missense probably benign 0.00
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1888:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R1891:Mybbp1a UTSW 11 72446037 missense probably benign 0.18
R2074:Mybbp1a UTSW 11 72441445 missense probably benign 0.01
R2257:Mybbp1a UTSW 11 72446195 missense probably benign 0.10
R3739:Mybbp1a UTSW 11 72448737 missense possibly damaging 0.77
R3983:Mybbp1a UTSW 11 72447170 missense probably damaging 1.00
R4191:Mybbp1a UTSW 11 72451287 missense probably damaging 0.97
R4660:Mybbp1a UTSW 11 72445712 missense probably benign 0.02
R4667:Mybbp1a UTSW 11 72447971 missense possibly damaging 0.94
R4769:Mybbp1a UTSW 11 72445640 missense probably damaging 1.00
R4982:Mybbp1a UTSW 11 72445214 missense probably damaging 0.99
R5451:Mybbp1a UTSW 11 72448113 missense probably damaging 0.99
R5514:Mybbp1a UTSW 11 72450636 missense possibly damaging 0.61
R5548:Mybbp1a UTSW 11 72446172 missense probably damaging 1.00
R5673:Mybbp1a UTSW 11 72444925 missense probably benign 0.30
R5947:Mybbp1a UTSW 11 72442431 missense probably damaging 1.00
R6161:Mybbp1a UTSW 11 72446012 missense probably damaging 1.00
R6785:Mybbp1a UTSW 11 72447566 missense probably benign 0.00
X0050:Mybbp1a UTSW 11 72441677 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGTCTTGTGAAACCTCCC -3'
(R):5'- TACCTTGAAGATGTGGAGGCCC -3'

Sequencing Primer
(F):5'- GTGAAACCTCCCTCCCTCTTAC -3'
(R):5'- CCACCAGAAGCAGCAGGTG -3'
Posted On2014-06-30