Incidental Mutation 'R1894:Myo15b'
ID211828
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
MMRRC Submission 039914-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R1894 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115887073 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 1049 (G1049S)
Ref Sequence ENSEMBL: ENSMUSP00000152405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040703] [ENSMUST00000093911] [ENSMUST00000125835] [ENSMUST00000167507] [ENSMUST00000222123]
Predicted Effect probably damaging
Transcript: ENSMUST00000040703
AA Change: G817S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000048072
Gene: ENSMUSG00000034427
AA Change: G817S

DomainStartEndE-ValueType
low complexity region 93 111 N/A INTRINSIC
low complexity region 179 213 N/A INTRINSIC
low complexity region 250 289 N/A INTRINSIC
low complexity region 345 370 N/A INTRINSIC
low complexity region 497 511 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
Blast:MYSc 587 775 3e-15 BLAST
SH3 778 835 1.15e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000093911
AA Change: G2471S
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427
AA Change: G2471S

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125835
AA Change: G114S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144423
Gene: ENSMUSG00000034427
AA Change: G114S

DomainStartEndE-ValueType
SH3 75 132 7e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141947
Predicted Effect probably benign
Transcript: ENSMUST00000167507
SMART Domains Protein: ENSMUSP00000129226
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
Pfam:MyTH4 100 205 3.1e-24 PFAM
B41 207 410 6.99e-4 SMART
low complexity region 418 428 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000222123
AA Change: G1049S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0284 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A T 1: 105,664,576 I157F probably benign Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Ago4 A G 4: 126,512,600 Y306H probably benign Het
Cblc T C 7: 19,792,577 T196A probably damaging Het
Ccdc109b T C 3: 129,934,663 H55R probably benign Het
Cfap52 T A 11: 67,953,619 probably null Het
Cops3 T C 11: 59,820,018 N375S probably benign Het
Crb1 T C 1: 139,243,193 T759A probably benign Het
Dnah3 T C 7: 120,086,334 K153E probably benign Het
Elovl1 C T 4: 118,430,748 S27F probably damaging Het
Erc2 A G 14: 28,141,228 E804G probably damaging Het
Fam110b G T 4: 5,798,840 C86F probably damaging Het
Fbn1 T A 2: 125,394,621 R380W probably damaging Het
Gatad2a C T 8: 69,916,651 R221Q probably damaging Het
Gcn1l1 C T 5: 115,589,115 P677L probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Gm9817 T C 13: 45,079,129 V136A unknown Het
Gmip T A 8: 69,820,972 L971H probably damaging Het
Gnptab G A 10: 88,419,127 E192K possibly damaging Het
Grm7 G A 6: 111,358,607 V660I probably benign Het
Helz2 G A 2: 181,234,289 P1471S probably damaging Het
Herc1 G A 9: 66,479,461 G3786S probably damaging Het
Isg20 T C 7: 78,919,899 V206A probably benign Het
Jund T A 8: 70,699,821 I255N probably damaging Het
Kcnt2 A T 1: 140,425,341 I263F probably damaging Het
Kif2c A T 4: 117,162,223 L561Q probably benign Het
Klhl3 T C 13: 58,009,375 D546G probably damaging Het
Klk1b4 A T 7: 44,209,630 Q24L probably benign Het
Ltbp2 A T 12: 84,787,961 C225S probably damaging Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Med18 G A 4: 132,459,931 R86* probably null Het
Mfsd2b T C 12: 4,869,155 E63G probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Nfrkb T A 9: 31,414,768 V1169E probably benign Het
Nr2f2 T A 7: 70,354,671 M411L probably benign Het
Nup155 A T 15: 8,157,760 H1391L probably damaging Het
Nup214 A T 2: 31,996,380 T585S possibly damaging Het
Olfr1025-ps1 C T 2: 85,918,255 T110I probably benign Het
Olfr807 A T 10: 129,755,074 C125* probably null Het
Olfr873 T C 9: 20,300,337 S47P probably benign Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pih1d1 T A 7: 45,157,741 I166N probably damaging Het
Prl2c5 T C 13: 13,191,678 F181L probably benign Het
Prx C T 7: 27,519,110 T1012I possibly damaging Het
Rassf8 T A 6: 145,808,473 V5E probably damaging Het
Rassf9 C A 10: 102,544,894 R44S possibly damaging Het
Sde2 G A 1: 180,860,008 S153N probably benign Het
Sec16b T A 1: 157,552,975 M372K possibly damaging Het
Sgcd A T 11: 47,195,110 I71N probably damaging Het
Slco5a1 C T 1: 12,872,259 C721Y probably damaging Het
Slx4ip A T 2: 137,068,118 K344N probably benign Het
Sorcs3 A T 19: 48,794,274 Q1076L probably benign Het
Spata21 A T 4: 141,111,381 N581I possibly damaging Het
Spata31d1d G T 13: 59,728,122 P533H probably benign Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Tex14 T G 11: 87,474,448 F61V probably damaging Het
Timp3 C T 10: 86,345,852 R196* probably null Het
Tll2 A G 19: 41,088,671 probably null Het
Tppp A G 13: 74,021,207 D22G possibly damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Uaca T C 9: 60,870,436 S702P possibly damaging Het
Uggt2 T C 14: 119,049,718 E146G probably damaging Het
Vmn1r233 T C 17: 20,993,732 S319G probably benign Het
Wdr47 A T 3: 108,623,376 Q395L possibly damaging Het
Wrnip1 A G 13: 32,805,336 probably null Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0815:Myo15b UTSW 11 115866336 splice site probably benign
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCGGGTAGTAAATAGCTCACC -3'
(R):5'- AGTTAGGCCTGTATCACTTCACC -3'

Sequencing Primer
(F):5'- AGGACTCCGGCTATGTCATC -3'
(R):5'- AGGCCTGTATCACTTCACCTCTTC -3'
Posted On2014-06-30