Incidental Mutation 'R1888:Abcc9'
ID211888
Institutional Source Beutler Lab
Gene Symbol Abcc9
Ensembl Gene ENSMUSG00000030249
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 9
SynonymsSUR2B, Sur2, SUR2A
MMRRC Submission 039909-MU
Accession Numbers

Ncbi RefSeq: NM_001044720.1; MGI: 1352630

Is this an essential gene? Probably non essential (E-score: 0.228) question?
Stock #R1888 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location142587862-142702315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 142679314 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 452 (S452P)
Ref Sequence ENSEMBL: ENSMUSP00000144779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073173] [ENSMUST00000087527] [ENSMUST00000100827] [ENSMUST00000111771] [ENSMUST00000205202]
Predicted Effect probably benign
Transcript: ENSMUST00000073173
AA Change: S452P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072914
Gene: ENSMUSG00000030249
AA Change: S452P

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.7e-33 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 6.6e-35 PFAM
AAA 1300 1502 9.94e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087527
AA Change: S452P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084805
Gene: ENSMUSG00000030249
AA Change: S452P

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 8e-33 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 6.8e-35 PFAM
AAA 1335 1537 9.94e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100827
AA Change: S452P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098390
Gene: ENSMUSG00000030249
AA Change: S452P

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 7.1e-35 PFAM
AAA 694 902 3.11e-13 SMART
coiled coil region 916 970 N/A INTRINSIC
Pfam:ABC_membrane 991 1263 5.2e-38 PFAM
AAA 1335 1520 5.13e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111771
AA Change: S452P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107401
Gene: ENSMUSG00000030249
AA Change: S452P

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 1.4e-32 PFAM
AAA 694 889 3.77e-12 SMART
coiled coil region 903 957 N/A INTRINSIC
Pfam:ABC_membrane 978 1250 1.2e-34 PFAM
AAA 1322 1524 9.94e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205202
AA Change: S452P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144779
Gene: ENSMUSG00000030249
AA Change: S452P

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 71 93 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
Pfam:ABC_membrane 297 583 6.9e-35 PFAM
AAA 659 867 3.11e-13 SMART
coiled coil region 881 935 N/A INTRINSIC
Pfam:ABC_membrane 956 1228 5e-38 PFAM
AAA 1300 1502 9.94e-12 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype Strain: 2155916
Lethality: D42-D210
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein is thought to form ATP-sensitive potassium channels in cardiac, skeletal, and vascular and non-vascular smooth muscle. Protein structure suggests a role as the drug-binding channel-modulating subunit of the extrapancreatic ATP-sensitive potassium channels. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null allele display lower serum glucose, enhanced insulin action, growth retardation, hypertension and spontaneous death due to episodic coronary artery vasospasm. Homozygous exon 5 deletion leads to cardiac mitochondrial defects, cardiomyopathy, and early postnatal death. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,283 K845E possibly damaging Het
4930447C04Rik A G 12: 72,913,256 M80T unknown Het
4930578I06Rik A G 14: 63,986,183 L48P probably damaging Het
Adgrb2 T C 4: 130,013,626 F977S probably damaging Het
Adgrf5 T G 17: 43,427,005 probably null Het
Adgrl4 A G 3: 151,439,277 N21S probably benign Het
Adss A T 1: 177,784,951 Y77* probably null Het
Ahnak A T 19: 9,007,088 D1912V probably damaging Het
Ahnak2 A G 12: 112,773,891 M1249T possibly damaging Het
Akap6 A T 12: 53,142,175 D2124V possibly damaging Het
Bbs12 C A 3: 37,320,563 L387I probably damaging Het
Cbwd1 A T 19: 24,955,405 V88D probably damaging Het
Ciita T C 16: 10,511,084 Y411H probably damaging Het
Ckb TCCACCACCA TCCACCA 12: 111,669,645 probably benign Het
Clec9a G A 6: 129,410,286 V35I probably benign Het
Cntn5 T A 9: 9,984,077 Q382L possibly damaging Het
Dock2 A T 11: 34,707,342 I334N probably damaging Het
Dock9 G T 14: 121,625,205 T833K probably benign Het
Drd2 G A 9: 49,402,142 V204I probably benign Het
Fam120a A T 13: 48,885,866 I938N possibly damaging Het
Fndc1 T C 17: 7,771,789 E1025G unknown Het
Fsip2 G A 2: 82,944,160 D64N probably benign Het
Gm12794 T A 4: 101,941,138 V102E probably damaging Het
Gm14496 T A 2: 182,000,196 C553* probably null Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm6020 C T 19: 61,183,953 H22Y possibly damaging Het
Hexa A G 9: 59,557,303 T159A probably benign Het
Hmcn1 C G 1: 150,819,500 A218P possibly damaging Het
Hpgds A G 6: 65,138,233 F22S probably damaging Het
Il5ra T A 6: 106,731,913 N289Y probably damaging Het
Irf2 A T 8: 46,807,353 R107* probably null Het
Kcnk6 T C 7: 29,225,650 I180M probably benign Het
Krtap5-3 G A 7: 142,202,242 probably benign Het
Lrig1 C T 6: 94,654,878 A114T probably benign Het
Lrrc37a A G 11: 103,498,761 V1946A probably benign Het
Lrrc8b T C 5: 105,481,351 V521A probably benign Het
Macf1 T G 4: 123,455,042 I2154L possibly damaging Het
Macf1 C A 4: 123,474,712 E2085D probably benign Het
Maml1 C T 11: 50,266,641 A236T probably benign Het
Mdc1 C A 17: 35,854,225 T1481K probably benign Het
Mecp2 C T X: 74,037,175 A79T probably damaging Het
Mfap3l T C 8: 60,671,390 V222A possibly damaging Het
Mis18bp1 A G 12: 65,149,328 I554T probably benign Het
Mpped2 T C 2: 106,699,445 I13T probably benign Het
Mthfd1l C A 10: 4,106,528 T948K probably damaging Het
Mtus1 C T 8: 41,084,325 S118N probably damaging Het
Mtx3 A G 13: 92,847,683 E156G probably benign Het
Mybbp1a C T 11: 72,446,037 T565I probably benign Het
Myh2 G A 11: 67,180,850 V498M probably damaging Het
Myo15b G A 11: 115,887,073 G1049S probably damaging Het
Myo1b T A 1: 51,760,403 probably null Het
Ndufa2 T A 18: 36,744,520 probably benign Het
Nipal2 T C 15: 34,625,021 I129M possibly damaging Het
Nt5dc3 A G 10: 86,834,062 N507S possibly damaging Het
Olfr1271 A G 2: 90,265,569 L287P probably damaging Het
Olfr875 T A 9: 37,772,867 D69E possibly damaging Het
Pcdhb17 G A 18: 37,487,385 probably null Het
Pcyt2 A G 11: 120,617,851 M1T probably null Het
Pla2g2d T C 4: 138,775,815 M1T probably null Het
Plekhg6 T C 6: 125,363,343 T685A probably damaging Het
Pxk T C 14: 8,151,540 S452P probably damaging Het
Rab42 A T 4: 132,303,218 D40E probably benign Het
Rapgef6 A C 11: 54,660,828 T836P probably damaging Het
Serpina3a A G 12: 104,116,103 D45G probably benign Het
Sntb1 T A 15: 55,749,349 R278* probably null Het
Spice1 T G 16: 44,365,626 S111A probably damaging Het
Stk40 T A 4: 126,125,745 L90Q probably damaging Het
Syk A G 13: 52,640,790 Y520C probably damaging Het
Syngr2 G A 11: 117,813,398 V170M possibly damaging Het
Tcf12 A T 9: 71,858,534 D541E possibly damaging Het
Tedc2 T A 17: 24,216,317 E366V probably damaging Het
Tedc2 C A 17: 24,216,318 E366* probably null Het
Tlr4 T C 4: 66,841,172 V734A probably damaging Het
Tmem132a T C 19: 10,863,499 E389G probably damaging Het
Tmem150b A G 7: 4,709,045 I112T probably benign Het
Tril A G 6: 53,819,592 L215P probably damaging Het
Trim24 G T 6: 37,957,078 R652L probably damaging Het
Ttn G A 2: 76,792,807 P15429S probably damaging Het
Ttn T A 2: 76,875,958 probably benign Het
Tubgcp2 A G 7: 139,999,270 V701A probably damaging Het
Tubgcp2 A G 7: 140,006,156 F407L probably damaging Het
Vmn1r30 A C 6: 58,435,490 L119R possibly damaging Het
Washc5 A C 15: 59,359,325 L363R probably damaging Het
Zan T C 5: 137,389,328 T4874A unknown Het
Zfp420 A T 7: 29,874,508 H51L probably damaging Het
Zfp512b C A 2: 181,588,442 R497L probably damaging Het
Zmat4 A G 8: 24,015,161 N139S probably damaging Het
Other mutations in Abcc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Abcc9 APN 6 142633190 splice site probably benign
IGL00670:Abcc9 APN 6 142687281 missense probably damaging 1.00
IGL00675:Abcc9 APN 6 142664621 missense probably damaging 1.00
IGL00741:Abcc9 APN 6 142687230 missense probably benign
IGL01371:Abcc9 APN 6 142656614 missense probably benign 0.04
IGL01686:Abcc9 APN 6 142603075 missense possibly damaging 0.71
IGL01724:Abcc9 APN 6 142664533 missense probably benign 0.00
IGL01807:Abcc9 APN 6 142605914 missense probably damaging 1.00
IGL01941:Abcc9 APN 6 142605904 missense probably damaging 1.00
IGL01946:Abcc9 APN 6 142626037 missense probably benign 0.16
IGL02210:Abcc9 APN 6 142687371 missense probably damaging 1.00
IGL02498:Abcc9 APN 6 142671539 critical splice donor site probably null
IGL02535:Abcc9 APN 6 142628426 missense probably benign 0.00
IGL02552:Abcc9 APN 6 142605919 missense possibly damaging 0.94
IGL02812:Abcc9 APN 6 142697790 missense possibly damaging 0.77
IGL02954:Abcc9 APN 6 142646281 missense probably damaging 0.97
IGL03035:Abcc9 APN 6 142627593 missense probably damaging 1.00
IGL03040:Abcc9 APN 6 142652597 nonsense probably null
IGL03100:Abcc9 APN 6 142694544 missense probably damaging 1.00
IGL03157:Abcc9 APN 6 142605923 splice site probably benign
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0054:Abcc9 UTSW 6 142601774 critical splice donor site probably null
R0084:Abcc9 UTSW 6 142658551 missense probably damaging 0.97
R0211:Abcc9 UTSW 6 142688984 missense probably benign 0.01
R0349:Abcc9 UTSW 6 142664625 missense probably benign 0.00
R0387:Abcc9 UTSW 6 142639504 nonsense probably null
R0393:Abcc9 UTSW 6 142645878 splice site probably benign
R0528:Abcc9 UTSW 6 142692880 missense probably damaging 1.00
R0588:Abcc9 UTSW 6 142603061 nonsense probably null
R0646:Abcc9 UTSW 6 142682104 missense probably benign 0.05
R0691:Abcc9 UTSW 6 142639253 missense possibly damaging 0.94
R0881:Abcc9 UTSW 6 142646303 missense probably damaging 1.00
R1264:Abcc9 UTSW 6 142646377 splice site probably benign
R1340:Abcc9 UTSW 6 142682855 splice site probably benign
R1413:Abcc9 UTSW 6 142590496 missense probably damaging 1.00
R1413:Abcc9 UTSW 6 142627519 missense possibly damaging 0.65
R1535:Abcc9 UTSW 6 142664635 missense probably damaging 1.00
R1595:Abcc9 UTSW 6 142633095 missense probably benign 0.02
R1670:Abcc9 UTSW 6 142594722 missense possibly damaging 0.89
R1769:Abcc9 UTSW 6 142627468 splice site probably benign
R1888:Abcc9 UTSW 6 142679314 missense probably benign
R1918:Abcc9 UTSW 6 142697682 missense probably damaging 1.00
R1925:Abcc9 UTSW 6 142671607 missense probably damaging 0.98
R2019:Abcc9 UTSW 6 142675434 missense probably damaging 1.00
R2698:Abcc9 UTSW 6 142633136 missense possibly damaging 0.93
R2860:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2861:Abcc9 UTSW 6 142626010 missense probably benign 0.01
R2980:Abcc9 UTSW 6 142687308 missense probably benign 0.00
R3115:Abcc9 UTSW 6 142689029 missense probably benign 0.08
R3617:Abcc9 UTSW 6 142679289 missense probably damaging 0.97
R3880:Abcc9 UTSW 6 142639233 missense probably damaging 1.00
R4063:Abcc9 UTSW 6 142605919 missense possibly damaging 0.94
R4065:Abcc9 UTSW 6 142645890 missense probably damaging 1.00
R4290:Abcc9 UTSW 6 142594012 missense probably benign 0.08
R4538:Abcc9 UTSW 6 142614412 critical splice donor site probably null
R4615:Abcc9 UTSW 6 142689107 missense possibly damaging 0.93
R4659:Abcc9 UTSW 6 142672595 splice site probably null
R4774:Abcc9 UTSW 6 142639317 missense probably damaging 1.00
R4788:Abcc9 UTSW 6 142620730 nonsense probably null
R4832:Abcc9 UTSW 6 142671556 missense probably damaging 1.00
R4844:Abcc9 UTSW 6 142689098 missense probably benign 0.09
R4903:Abcc9 UTSW 6 142600965 missense probably damaging 1.00
R4921:Abcc9 UTSW 6 142590436 missense probably benign
R4960:Abcc9 UTSW 6 142620783 splice site probably null
R4983:Abcc9 UTSW 6 142682141 missense probably benign 0.44
R4986:Abcc9 UTSW 6 142627591 missense probably benign 0.00
R5060:Abcc9 UTSW 6 142626110 intron probably benign
R5120:Abcc9 UTSW 6 142656618 missense probably benign 0.00
R5198:Abcc9 UTSW 6 142626000 missense probably benign 0.00
R5301:Abcc9 UTSW 6 142590481 missense probably benign 0.41
R5328:Abcc9 UTSW 6 142682059 missense probably benign 0.25
R5568:Abcc9 UTSW 6 142689016 missense possibly damaging 0.62
R5654:Abcc9 UTSW 6 142625645 intron probably benign
R5694:Abcc9 UTSW 6 142600947 missense probably damaging 1.00
R5734:Abcc9 UTSW 6 142625731 intron probably benign
R5774:Abcc9 UTSW 6 142628559 missense probably damaging 0.98
R5802:Abcc9 UTSW 6 142656676 critical splice acceptor site probably null
R5890:Abcc9 UTSW 6 142604828 critical splice donor site probably null
R5946:Abcc9 UTSW 6 142625952 missense probably damaging 1.00
R5971:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6078:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
R6392:Abcc9 UTSW 6 142682099 missense probably damaging 1.00
R6400:Abcc9 UTSW 6 142692709 makesense probably null
R6478:Abcc9 UTSW 6 142679308 missense probably damaging 1.00
R6481:Abcc9 UTSW 6 142604895 missense probably damaging 0.99
R6564:Abcc9 UTSW 6 142603108 missense probably damaging 1.00
R6700:Abcc9 UTSW 6 142687287 missense possibly damaging 0.94
R6902:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6946:Abcc9 UTSW 6 142679227 missense probably damaging 1.00
R6989:Abcc9 UTSW 6 142688981 missense probably damaging 0.97
R7052:Abcc9 UTSW 6 142658535 missense probably benign 0.00
R7062:Abcc9 UTSW 6 142599146 missense probably damaging 1.00
R7121:Abcc9 UTSW 6 142689127 nonsense probably null
U15987:Abcc9 UTSW 6 142639575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCCTCTTGTATTATAAAAGTGTAC -3'
(R):5'- CCCCAGATAAACTTCCCATGATATT -3'

Sequencing Primer
(F):5'- TGTACAAATCAAGCCAAGCGG -3'
(R):5'- CTCAGCGACAGCATTTGT -3'
Posted On2014-06-30