Incidental Mutation 'R0123:Hira'
ID21192
Institutional Source Beutler Lab
Gene Symbol Hira
Ensembl Gene ENSMUSG00000022702
Gene Namehistone cell cycle regulator
SynonymsD16Ertd95e, Gm15797, Tuple1
MMRRC Submission 038408-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0123 (G1)
Quality Score193
Status Validated (trace)
Chromosome16
Chromosomal Location18877037-18970309 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18956171 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 949 (F949I)
Ref Sequence ENSEMBL: ENSMUSP00000004222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004222] [ENSMUST00000190050]
Predicted Effect probably benign
Transcript: ENSMUST00000004222
AA Change: F949I

PolyPhen 2 Score 0.449 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000004222
Gene: ENSMUSG00000022702
AA Change: F949I

DomainStartEndE-ValueType
WD40 1 44 1.56e-1 SMART
WD40 59 98 9.67e-7 SMART
WD40 120 159 3.58e-10 SMART
WD40 163 202 7.22e-6 SMART
WD40 212 254 9.17e1 SMART
WD40 257 313 1.54e0 SMART
WD40 319 356 2.86e0 SMART
low complexity region 405 412 N/A INTRINSIC
Pfam:HIRA_B 448 470 1.9e-10 PFAM
low complexity region 493 507 N/A INTRINSIC
low complexity region 540 556 N/A INTRINSIC
low complexity region 600 614 N/A INTRINSIC
low complexity region 626 641 N/A INTRINSIC
Pfam:Hira 761 960 2.9e-61 PFAM
low complexity region 979 989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190050
SMART Domains Protein: ENSMUSP00000141101
Gene: ENSMUSG00000099908

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232419
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.1%
  • 10x: 95.8%
  • 20x: 91.1%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a histone chaperone that preferentially places the variant histone H3.3 in nucleosomes. Orthologs of this gene in yeast, flies, and plants are necessary for the formation of transcriptionally silent heterochomatin. This gene plays an important role in the formation of the senescence-associated heterochromatin foci. These foci likely mediate the irreversible cell cycle changes that occur in senescent cells. It is considered the primary candidate gene in some haploinsufficiency syndromes such as DiGeorge syndrome, and insufficient production of the gene may disrupt normal embryonic development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted gastrulation, malformations of axial and paraxial mesoendoderm, abnormal placentas, failure of cardiac development, and lethality by embryonic day 11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,201 probably benign Het
4931417E11Rik A G 6: 73,469,419 L49P possibly damaging Het
Abca16 T A 7: 120,540,155 L1470Q probably damaging Het
Abraxas2 G A 7: 132,874,855 R105Q probably damaging Het
AW549877 T C 15: 3,986,294 K263E probably damaging Het
Becn1 A G 11: 101,290,498 Y326H probably damaging Het
Bicd1 T C 6: 149,512,950 I387T probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Cacna1g T A 11: 94,409,476 H2156L probably damaging Het
Cd22 A G 7: 30,867,108 probably benign Het
Cd59b G A 2: 104,078,941 probably null Het
Chn2 T C 6: 54,290,451 probably benign Het
Cmya5 A G 13: 93,095,904 L892P possibly damaging Het
Col5a2 A G 1: 45,407,035 I461T probably benign Het
Cts8 T A 13: 61,253,577 M75L probably benign Het
Ddx50 A T 10: 62,621,377 probably benign Het
Dlg5 T C 14: 24,147,206 M1558V probably benign Het
Dnlz T C 2: 26,351,368 N116S probably damaging Het
Efcab14 T C 4: 115,740,531 F108L probably damaging Het
Ell2 T C 13: 75,762,140 probably benign Het
Fam160b1 G A 19: 57,381,407 D461N probably benign Het
Fam234b T G 6: 135,217,074 S242A possibly damaging Het
Garnl3 T C 2: 33,006,804 T608A possibly damaging Het
Gata3 T C 2: 9,874,809 T119A probably benign Het
Hdac2 T A 10: 36,989,184 D131E probably benign Het
Il3 A G 11: 54,265,680 probably null Het
Itgb3 A T 11: 104,637,088 K216N probably damaging Het
Kctd21 T A 7: 97,348,091 I257N probably benign Het
Kif16b A T 2: 142,672,375 S1215T probably benign Het
Lhx9 A T 1: 138,838,679 C124S probably damaging Het
Lrch3 T A 16: 32,961,754 probably benign Het
Lrp1b T C 2: 40,596,983 E142G probably damaging Het
Macf1 T C 4: 123,432,843 M2835V possibly damaging Het
Mndal A T 1: 173,857,513 probably benign Het
Mug2 G T 6: 122,074,714 V952L possibly damaging Het
Nepn A T 10: 52,400,437 T29S probably damaging Het
Nlgn1 C T 3: 25,435,925 C546Y probably damaging Het
Notch4 C T 17: 34,565,363 R43W possibly damaging Het
Nrxn1 A T 17: 90,995,487 probably null Het
Olfr1055 T C 2: 86,347,728 I13V possibly damaging Het
Olfr307 A G 7: 86,335,595 I267T probably benign Het
Phf3 A T 1: 30,805,065 D1604E probably benign Het
Plekhn1 T C 4: 156,228,243 R53G probably benign Het
Pnp2 T C 14: 50,963,177 F100S probably damaging Het
Rxfp1 A G 3: 79,657,476 S327P probably damaging Het
Siah2 A G 3: 58,676,115 V250A probably damaging Het
Slc10a7 T A 8: 78,697,158 probably null Het
Slc9a1 A G 4: 133,420,605 K645E probably benign Het
Smarca4 T C 9: 21,637,324 L302P probably damaging Het
Tas2r120 T A 6: 132,657,589 Y211* probably null Het
Tenm3 A T 8: 48,674,472 L57Q probably damaging Het
Tep1 C T 14: 50,829,693 V2269I possibly damaging Het
Tpd52l1 A G 10: 31,379,256 S32P probably damaging Het
Tsfm A G 10: 127,022,929 probably benign Het
Ttn T A 2: 76,710,124 R34173W probably damaging Het
Ttn C A 2: 76,793,130 V15368L possibly damaging Het
Upk1a A T 7: 30,612,394 I25N possibly damaging Het
Vmn1r45 A T 6: 89,933,510 Y159* probably null Het
Vmn2r13 C A 5: 109,175,049 V125L probably benign Het
Vps13b T C 15: 35,887,261 I3272T probably benign Het
Zfp108 A G 7: 24,260,467 H161R probably benign Het
Zfp982 A T 4: 147,512,636 K150I probably benign Het
Zfyve1 A G 12: 83,555,073 probably benign Het
Zswim8 T C 14: 20,716,490 probably benign Het
Other mutations in Hira
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Hira APN 16 18946340 splice site probably benign
IGL01285:Hira APN 16 18912180 missense probably benign 0.01
F5770:Hira UTSW 16 18894821 missense probably damaging 1.00
IGL02796:Hira UTSW 16 18925654 missense probably benign 0.01
R0225:Hira UTSW 16 18956171 missense probably benign 0.45
R0606:Hira UTSW 16 18935047 missense probably benign 0.00
R1017:Hira UTSW 16 18899347 intron probably null
R1456:Hira UTSW 16 18925663 missense probably benign 0.02
R1479:Hira UTSW 16 18896469 missense probably damaging 1.00
R1731:Hira UTSW 16 18933014 missense probably benign 0.01
R1830:Hira UTSW 16 18947414 missense probably damaging 1.00
R2039:Hira UTSW 16 18951701 missense probably benign 0.05
R4328:Hira UTSW 16 18896612 missense probably benign 0.01
R4401:Hira UTSW 16 18925720 missense probably damaging 1.00
R4423:Hira UTSW 16 18956202 missense possibly damaging 0.80
R4634:Hira UTSW 16 18946400 missense probably damaging 0.98
R4728:Hira UTSW 16 18922904 missense probably damaging 1.00
R5050:Hira UTSW 16 18925859 missense possibly damaging 0.75
R5139:Hira UTSW 16 18954758 missense probably damaging 1.00
R5201:Hira UTSW 16 18952115 missense probably damaging 0.98
R5327:Hira UTSW 16 18954758 missense probably damaging 1.00
R5483:Hira UTSW 16 18969540 missense possibly damaging 0.89
R5573:Hira UTSW 16 18916599 missense probably damaging 1.00
R5626:Hira UTSW 16 18927512 missense probably damaging 0.97
R5768:Hira UTSW 16 18935018 splice site probably benign
R5952:Hira UTSW 16 18935065 missense possibly damaging 0.83
R6128:Hira UTSW 16 18932977 missense probably benign 0.08
R6280:Hira UTSW 16 18910707 missense probably damaging 1.00
R7116:Hira UTSW 16 18912114 missense probably damaging 1.00
V7581:Hira UTSW 16 18894821 missense probably damaging 1.00
V7582:Hira UTSW 16 18894821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATTGTCCAGGGGCTGATGAATG -3'
(R):5'- GCCTAAGTGTGCCACCTTACCAAAG -3'

Sequencing Primer
(F):5'- CAGGGGCTGATGAATGAGTGAG -3'
(R):5'- atctgcctgcatctgtctc -3'
Posted On2013-04-11