Incidental Mutation 'R1896:Abo'
ID211955
Institutional Source Beutler Lab
Gene Symbol Abo
Ensembl Gene ENSMUSG00000015787
Gene NameABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-3-galactosyltransferase)
Synonymscis-AB transferase
MMRRC Submission 039916-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1896 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26842503-26864979 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26843597 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 199 (D199Y)
Ref Sequence ENSEMBL: ENSMUSP00000109679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102900] [ENSMUST00000114045]
Predicted Effect probably damaging
Transcript: ENSMUST00000102900
AA Change: D197Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099964
Gene: ENSMUSG00000015787
AA Change: D197Y

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 34 332 2.7e-155 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114045
AA Change: D199Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109679
Gene: ENSMUSG00000015787
AA Change: D199Y

DomainStartEndE-ValueType
Pfam:Glyco_transf_6 34 334 1.7e-154 PFAM
Meta Mutation Damage Score 0.386 question?
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes proteins related to the first discovered blood group system, ABO. Which allele is present in an individual determines the blood group. The 'O' blood group is caused by a deletion of guanine-258 near the N-terminus of the protein which results in a frameshift and translation of an almost entirely different protein. Individuals with the A, B, and AB alleles express glycosyltransferase activities that convert the H antigen into the A or B antigen. Other minor alleles have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik C T 2: 156,865,332 P64S probably damaging Het
1810046K07Rik A G 9: 51,291,798 S19P probably damaging Het
4932438A13Rik C T 3: 36,908,231 Q494* probably null Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
C1qtnf1 G T 11: 118,443,757 G21V probably damaging Het
Car13 T C 3: 14,645,175 I59T probably benign Het
Cep97 T C 16: 55,927,744 N108D probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Endou A G 15: 97,712,992 Y404H probably damaging Het
F12 T C 13: 55,420,727 Y373C probably damaging Het
Fam221b T C 4: 43,660,375 T405A probably damaging Het
Fetub A G 16: 22,932,295 R131G probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Ggt5 T C 10: 75,604,726 V227A probably damaging Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gm13089 C G 4: 143,698,144 G243A probably benign Het
Gphn A G 12: 78,412,354 D72G possibly damaging Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Jarid2 T C 13: 44,884,882 probably null Het
Kif21b C A 1: 136,147,845 R237S possibly damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lpin3 C T 2: 160,905,298 P815S probably damaging Het
Lrp1 T A 10: 127,559,998 I2468F possibly damaging Het
Nav1 T C 1: 135,460,737 N1118S probably benign Het
Ncoa3 T A 2: 166,048,464 I90N probably benign Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Pkd1l3 C A 8: 109,624,199 P559T possibly damaging Het
Prex1 T A 2: 166,586,654 I716F probably benign Het
Psap C T 10: 60,295,046 Q219* probably null Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Sned1 C T 1: 93,265,047 P352L probably benign Het
Sox4 T C 13: 28,952,144 Y293C probably damaging Het
Srgap3 T A 6: 112,738,997 H654L probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tll2 A G 19: 41,113,059 F379L probably benign Het
Traf3ip3 A G 1: 193,175,734 V492A probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Ush2a T C 1: 188,550,009 V1907A probably benign Het
Uso1 A T 5: 92,201,133 probably null Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve1 A C 12: 83,555,614 V469G probably damaging Het
Other mutations in Abo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02165:Abo APN 2 26843429 missense probably damaging 1.00
IGL02171:Abo APN 2 26848957 missense probably benign 0.06
IGL02825:Abo APN 2 26843698 missense possibly damaging 0.88
R0035:Abo UTSW 2 26843373 missense possibly damaging 0.90
R0414:Abo UTSW 2 26843416 missense probably damaging 1.00
R1813:Abo UTSW 2 26843597 missense probably damaging 1.00
R2129:Abo UTSW 2 26846574 missense probably benign 0.00
R4022:Abo UTSW 2 26843800 missense probably damaging 1.00
R6059:Abo UTSW 2 26843353 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCATCATAGCTTCATGGCAGG -3'
(R):5'- CTGATGTGCCACAGGTGATC -3'

Sequencing Primer
(F):5'- CATAGCTTCATGGCAGGCCTTG -3'
(R):5'- AGGTGATCCTGGGTGCAG -3'
Posted On2014-06-30