Incidental Mutation 'R0124:Stau2'
ID21197
Institutional Source Beutler Lab
Gene Symbol Stau2
Ensembl Gene ENSMUSG00000025920
Gene Namestaufen double-stranded RNA binding protein 2
Synonyms
MMRRC Submission 038409-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0124 (G1)
Quality Score225
Status Validated (trace)
Chromosome1
Chromosomal Location16228674-16520112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 16463128 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 61 (A61T)
Ref Sequence ENSEMBL: ENSMUSP00000117537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027052] [ENSMUST00000054668] [ENSMUST00000115359] [ENSMUST00000127420] [ENSMUST00000128957] [ENSMUST00000131257] [ENSMUST00000144138] [ENSMUST00000145092] [ENSMUST00000149320] [ENSMUST00000151888] [ENSMUST00000153966] [ENSMUST00000159558] [ENSMUST00000162007] [ENSMUST00000162435] [ENSMUST00000162627] [ENSMUST00000162751]
Predicted Effect unknown
Transcript: ENSMUST00000027052
AA Change: A29T
SMART Domains Protein: ENSMUSP00000027052
Gene: ENSMUSG00000025920
AA Change: A29T

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000054668
AA Change: A61T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000053190
Gene: ENSMUSG00000025920
AA Change: A61T

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 6e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000115359
AA Change: A61T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000111016
Gene: ENSMUSG00000025920
AA Change: A61T

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
low complexity region 76 94 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127420
AA Change: A29T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122116
Gene: ENSMUSG00000025920
AA Change: A29T

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-4 SMART
Blast:DSRM 5 42 9e-17 BLAST
Blast:DSRM 64 110 2e-25 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000128957
AA Change: A61T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122410
Gene: ENSMUSG00000025920
AA Change: A61T

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 2e-6 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000131257
AA Change: A23T

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121410
Gene: ENSMUSG00000025920
AA Change: A23T

DomainStartEndE-ValueType
SCOP:d1di2a_ 1 34 9e-3 SMART
DSRM 58 142 2.36e-7 SMART
DSRM 170 235 1.84e-18 SMART
DSRM 270 336 5.45e-21 SMART
low complexity region 409 427 N/A INTRINSIC
PDB:4DKK|A 428 473 2e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000144138
AA Change: A61T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119130
Gene: ENSMUSG00000025920
AA Change: A61T

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
low complexity region 76 94 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000145092
AA Change: A29T
SMART Domains Protein: ENSMUSP00000115041
Gene: ENSMUSG00000025920
AA Change: A29T

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 1e-4 SMART
Blast:DSRM 5 42 1e-16 BLAST
low complexity region 44 62 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000149320
AA Change: A61T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118489
Gene: ENSMUSG00000025920
AA Change: A61T

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
low complexity region 447 465 N/A INTRINSIC
PDB:4DKK|A 466 511 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000151888
SMART Domains Protein: ENSMUSP00000125473
Gene: ENSMUSG00000025920

DomainStartEndE-ValueType
Blast:DSRM 1 55 3e-35 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000153966
AA Change: A61T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117537
Gene: ENSMUSG00000025920
AA Change: A61T

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159558
AA Change: A29T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000125726
Gene: ENSMUSG00000025920
AA Change: A29T

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 2e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000162007
AA Change: A29T

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124303
Gene: ENSMUSG00000025920
AA Change: A29T

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 2e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 2e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000162435
AA Change: A29T
SMART Domains Protein: ENSMUSP00000123827
Gene: ENSMUSG00000025920
AA Change: A29T

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000162627
AA Change: A29T
SMART Domains Protein: ENSMUSP00000123781
Gene: ENSMUSG00000025920
AA Change: A29T

DomainStartEndE-ValueType
SCOP:d1di2a_ 5 40 3e-3 SMART
DSRM 64 148 2.36e-7 SMART
DSRM 176 241 1.84e-18 SMART
DSRM 276 342 5.45e-21 SMART
low complexity region 415 433 N/A INTRINSIC
PDB:4DKK|A 434 479 5e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000162751
AA Change: A61T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124505
Gene: ENSMUSG00000025920
AA Change: A61T

DomainStartEndE-ValueType
DSRM 9 74 1.17e-11 SMART
DSRM 96 180 2.36e-7 SMART
DSRM 208 273 1.84e-18 SMART
DSRM 308 374 5.45e-21 SMART
Pfam:Staufen_C 455 523 6.5e-19 PFAM
Meta Mutation Damage Score 0.376 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Staufen homolog 2 is a member of the family of double-stranded RNA (dsRNA)-binding proteins involved in the transport and/or localization of mRNAs to different subcellular compartments and/or organelles. These proteins are characterized by the presence of multiple dsRNA-binding domains which are required to bind RNAs having double-stranded secondary structures. Staufen homolog 2 shares 48.5% and 59.9% similarity with drosophila and human staufen, respectively. The exact function of Staufen homolog 2 is not known, but since it contains 3 copies of conserved dsRNA binding domain, it could be involved in double-stranded RNA binding events. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2009]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in Stau2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Stau2 APN 1 16345698 makesense probably null
IGL01809:Stau2 APN 1 16440315 splice site probably null
IGL01895:Stau2 APN 1 16345937 missense probably damaging 0.99
IGL02164:Stau2 APN 1 16345828 missense probably damaging 1.00
IGL02507:Stau2 APN 1 16486069 missense possibly damaging 0.93
R0595:Stau2 UTSW 1 16440450 missense probably damaging 1.00
R1104:Stau2 UTSW 1 16440361 nonsense probably null
R1296:Stau2 UTSW 1 16440372 missense probably benign
R1359:Stau2 UTSW 1 16392566 missense probably damaging 1.00
R2884:Stau2 UTSW 1 16231066 missense possibly damaging 0.81
R4066:Stau2 UTSW 1 16394059 missense possibly damaging 0.83
R4718:Stau2 UTSW 1 16346045 intron probably null
R5496:Stau2 UTSW 1 16390021 missense probably damaging 1.00
R6232:Stau2 UTSW 1 16374811 missense probably benign 0.00
R6447:Stau2 UTSW 1 16389825 missense possibly damaging 0.92
R6964:Stau2 UTSW 1 16390005 missense probably damaging 1.00
R7317:Stau2 UTSW 1 16460329 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCATTTGTATCCCCATGTGTTCTAGAC -3'
(R):5'- GTGTGTGAGTTTTCTCAGACCACCAG -3'

Sequencing Primer
(F):5'- tgtgtgtACTATTAACTTGGTGCTC -3'
(R):5'- CCAGTTTTTGTTCTATGgtgtttgtg -3'
Posted On2013-04-11