Incidental Mutation 'R1896:Jarid2'
ID212005
Institutional Source Beutler Lab
Gene Symbol Jarid2
Ensembl Gene ENSMUSG00000038518
Gene Namejumonji, AT rich interactive domain 2
Synonymsjumonji, Jmj
MMRRC Submission 039916-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1896 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location44729474-44921643 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 44884882 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044608] [ENSMUST00000172977] [ENSMUST00000173003] [ENSMUST00000173246] [ENSMUST00000173367] [ENSMUST00000173367] [ENSMUST00000173704] [ENSMUST00000173906]
Predicted Effect probably null
Transcript: ENSMUST00000044608
SMART Domains Protein: ENSMUSP00000037774
Gene: ENSMUSG00000038518

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172977
SMART Domains Protein: ENSMUSP00000134276
Gene: ENSMUSG00000038518

DomainStartEndE-ValueType
Blast:JmjC 8 61 4e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173003
Predicted Effect probably null
Transcript: ENSMUST00000173246
SMART Domains Protein: ENSMUSP00000134205
Gene: ENSMUSG00000038518

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1191 2.4e-14 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173367
SMART Domains Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
low complexity region 126 146 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
JmjN 415 456 1.77e-20 SMART
PDB:2RQ5|A 476 507 3e-14 PDB
Blast:ARID 477 507 2e-14 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000173367
SMART Domains Protein: ENSMUSP00000134658
Gene: ENSMUSG00000038518

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
low complexity region 126 146 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
JmjN 415 456 1.77e-20 SMART
PDB:2RQ5|A 476 507 3e-14 PDB
Blast:ARID 477 507 2e-14 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000173704
SMART Domains Protein: ENSMUSP00000134675
Gene: ENSMUSG00000038518

DomainStartEndE-ValueType
low complexity region 86 99 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
low complexity region 334 353 N/A INTRINSIC
JmjN 554 595 1.77e-20 SMART
ARID 616 707 4.96e-24 SMART
BRIGHT 620 712 1.7e-29 SMART
low complexity region 791 800 N/A INTRINSIC
JmjC 882 1046 1.04e-50 SMART
Pfam:zf-C5HC2 1137 1190 1e-10 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173906
SMART Domains Protein: ENSMUSP00000134630
Gene: ENSMUSG00000038518

DomainStartEndE-ValueType
low complexity region 48 61 N/A INTRINSIC
low complexity region 143 157 N/A INTRINSIC
low complexity region 227 247 N/A INTRINSIC
low complexity region 296 315 N/A INTRINSIC
JmjN 516 557 1.77e-20 SMART
ARID 578 669 4.96e-24 SMART
BRIGHT 582 674 1.7e-29 SMART
low complexity region 753 762 N/A INTRINSIC
JmjC 844 1008 1.04e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174683
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Jumonji- and AT-rich interaction domain (ARID)-domain-containing protein. The encoded protein is a DNA-binding protein that functions as a transcriptional repressor. This protein interacts with the Polycomb repressive complex 2 (PRC2) which plays an essential role in regulating gene expression during embryonic development. This protein facilitates the recruitment of the PRC2 complex to target genes. Alternate splicing results in multiple transcript variants. Mutations in this gene are associated with chronic myeloid malignancies. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutants show strain-specific phenotypes, including embryonic death and defective neural tube closure, impaired hematopoiesis and hypoplasia of liver, thymus and spleen. Homozygotes for another mutation die at birth with cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik C T 2: 156,865,332 P64S probably damaging Het
1810046K07Rik A G 9: 51,291,798 S19P probably damaging Het
4932438A13Rik C T 3: 36,908,231 Q494* probably null Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
C1qtnf1 G T 11: 118,443,757 G21V probably damaging Het
Car13 T C 3: 14,645,175 I59T probably benign Het
Cep97 T C 16: 55,927,744 N108D probably damaging Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Endou A G 15: 97,712,992 Y404H probably damaging Het
F12 T C 13: 55,420,727 Y373C probably damaging Het
Fam221b T C 4: 43,660,375 T405A probably damaging Het
Fetub A G 16: 22,932,295 R131G probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Ggt5 T C 10: 75,604,726 V227A probably damaging Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gm13089 C G 4: 143,698,144 G243A probably benign Het
Gphn A G 12: 78,412,354 D72G possibly damaging Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Kif21b C A 1: 136,147,845 R237S possibly damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lpin3 C T 2: 160,905,298 P815S probably damaging Het
Lrp1 T A 10: 127,559,998 I2468F possibly damaging Het
Nav1 T C 1: 135,460,737 N1118S probably benign Het
Ncoa3 T A 2: 166,048,464 I90N probably benign Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Pkd1l3 C A 8: 109,624,199 P559T possibly damaging Het
Prex1 T A 2: 166,586,654 I716F probably benign Het
Psap C T 10: 60,295,046 Q219* probably null Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Sned1 C T 1: 93,265,047 P352L probably benign Het
Sox4 T C 13: 28,952,144 Y293C probably damaging Het
Srgap3 T A 6: 112,738,997 H654L probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tll2 A G 19: 41,113,059 F379L probably benign Het
Traf3ip3 A G 1: 193,175,734 V492A probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Ush2a T C 1: 188,550,009 V1907A probably benign Het
Uso1 A T 5: 92,201,133 probably null Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve1 A C 12: 83,555,614 V469G probably damaging Het
Other mutations in Jarid2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01572:Jarid2 APN 13 44884835 missense probably damaging 1.00
IGL02217:Jarid2 APN 13 44913201 missense probably damaging 1.00
IGL02378:Jarid2 APN 13 44914325 missense probably damaging 0.98
IGL02604:Jarid2 APN 13 44874401 missense probably damaging 1.00
IGL02865:Jarid2 APN 13 44910560 missense probably damaging 1.00
IGL02926:Jarid2 APN 13 44902929 missense probably benign 0.03
R0057:Jarid2 UTSW 13 44884856 missense probably damaging 0.96
R0426:Jarid2 UTSW 13 44840882 critical splice donor site probably null
R0545:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R0562:Jarid2 UTSW 13 44902359 missense probably damaging 0.99
R1192:Jarid2 UTSW 13 44906545 missense probably damaging 1.00
R1241:Jarid2 UTSW 13 44884892 splice site probably benign
R1254:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1464:Jarid2 UTSW 13 44848381 missense probably damaging 0.97
R1552:Jarid2 UTSW 13 44911199 missense probably damaging 1.00
R1728:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1729:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1730:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1739:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1783:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1785:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1844:Jarid2 UTSW 13 44902743 missense possibly damaging 0.71
R1965:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1966:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R1995:Jarid2 UTSW 13 44874441 missense probably damaging 1.00
R2120:Jarid2 UTSW 13 44906336 missense probably benign 0.17
R2142:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2172:Jarid2 UTSW 13 44902539 missense probably damaging 0.99
R2242:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R2245:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3110:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3111:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3112:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3115:Jarid2 UTSW 13 44896466 missense probably damaging 1.00
R3620:Jarid2 UTSW 13 44906276 missense probably damaging 1.00
R3704:Jarid2 UTSW 13 44902355 missense probably benign
R3802:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R3804:Jarid2 UTSW 13 44902831 missense probably benign 0.10
R4126:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4127:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4128:Jarid2 UTSW 13 44902256 missense probably damaging 1.00
R4153:Jarid2 UTSW 13 44910426 missense probably damaging 1.00
R4844:Jarid2 UTSW 13 44913772 missense probably damaging 0.96
R5044:Jarid2 UTSW 13 44906565 missense probably damaging 1.00
R5329:Jarid2 UTSW 13 44906271 missense possibly damaging 0.49
R5632:Jarid2 UTSW 13 44896290 missense probably damaging 0.97
R5820:Jarid2 UTSW 13 44902301 missense possibly damaging 0.96
R6267:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6296:Jarid2 UTSW 13 44903063 missense possibly damaging 0.93
R6479:Jarid2 UTSW 13 44848289 missense probably benign 0.22
R6619:Jarid2 UTSW 13 44874396 missense probably damaging 1.00
R6633:Jarid2 UTSW 13 44884877 missense probably damaging 0.97
R6970:Jarid2 UTSW 13 44902985 missense probably damaging 1.00
R7020:Jarid2 UTSW 13 44884824 missense probably damaging 1.00
R7155:Jarid2 UTSW 13 44902462 missense probably damaging 1.00
R7223:Jarid2 UTSW 13 44896322 missense possibly damaging 0.89
R7265:Jarid2 UTSW 13 44902272 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCTGGAAGGGGTGAATGTC -3'
(R):5'- GTCATCTGTAGTTCCTACAACATTT -3'

Sequencing Primer
(F):5'- GAACTACATATGTTAAACCCATCAGG -3'
(R):5'- GGGCTGAACTACTAAGTTCT -3'
Posted On2014-06-30