Incidental Mutation 'R1896:Cep97'
ID212013
Institutional Source Beutler Lab
Gene Symbol Cep97
Ensembl Gene ENSMUSG00000022604
Gene Namecentrosomal protein 97
Synonyms4932439K18Rik, E130116N02Rik, Lrriq2, 2810403B08Rik
MMRRC Submission 039916-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.589) question?
Stock #R1896 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location55899888-55934855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55927744 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 108 (N108D)
Ref Sequence ENSEMBL: ENSMUSP00000113470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023270] [ENSMUST00000117468] [ENSMUST00000118500] [ENSMUST00000121129] [ENSMUST00000121703] [ENSMUST00000122280]
Predicted Effect probably damaging
Transcript: ENSMUST00000023270
AA Change: N108D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023270
Gene: ENSMUSG00000022604
AA Change: N108D

DomainStartEndE-ValueType
Pfam:LRR_9 98 259 1.8e-12 PFAM
IQ 549 571 2e-1 SMART
coiled coil region 576 609 N/A INTRINSIC
low complexity region 661 673 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 775 789 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117468
AA Change: N36D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112687
Gene: ENSMUSG00000022604
AA Change: N36D

DomainStartEndE-ValueType
Pfam:LRR_9 7 187 4.1e-12 PFAM
Pfam:LRR_8 30 86 1e-7 PFAM
Pfam:LRR_4 52 94 3.6e-8 PFAM
Pfam:LRR_1 53 73 1.3e-2 PFAM
IQ 477 499 2e-1 SMART
coiled coil region 504 537 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 703 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118500
AA Change: N36D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112663
Gene: ENSMUSG00000022604
AA Change: N36D

DomainStartEndE-ValueType
Pfam:LRR_9 7 187 4.1e-12 PFAM
Pfam:LRR_8 30 86 1e-7 PFAM
Pfam:LRR_4 52 94 3.6e-8 PFAM
Pfam:LRR_1 53 73 1.3e-2 PFAM
IQ 477 499 2e-1 SMART
coiled coil region 504 537 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 643 656 N/A INTRINSIC
low complexity region 703 717 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121129
AA Change: N108D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112502
Gene: ENSMUSG00000022604
AA Change: N108D

DomainStartEndE-ValueType
Pfam:LRR_6 79 103 2.8e-2 PFAM
Pfam:LRR_4 80 122 4.4e-8 PFAM
Pfam:LRR_8 80 136 7.2e-10 PFAM
Pfam:LRR_8 102 152 8.5e-8 PFAM
Pfam:LRR_1 103 123 5.2e-2 PFAM
Pfam:LRR_6 123 153 5.6e-4 PFAM
Pfam:LRR_7 124 143 1.4e-1 PFAM
Pfam:LRR_1 125 148 1.2e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121703
AA Change: N108D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113470
Gene: ENSMUSG00000022604
AA Change: N108D

DomainStartEndE-ValueType
Pfam:LRR_6 79 103 2.6e-2 PFAM
Pfam:LRR_4 80 122 4.1e-8 PFAM
Pfam:LRR_8 94 136 4.4e-8 PFAM
Pfam:LRR_1 103 123 4.9e-2 PFAM
Pfam:LRR_6 123 147 7e-4 PFAM
Pfam:LRR_7 124 143 1.3e-1 PFAM
Pfam:LRR_1 125 145 1.2e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122280
AA Change: N108D

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113009
Gene: ENSMUSG00000022604
AA Change: N108D

DomainStartEndE-ValueType
Pfam:LRR_6 79 103 2.7e-2 PFAM
Pfam:LRR_4 80 122 4.4e-8 PFAM
Pfam:LRR_8 94 136 4.5e-8 PFAM
Pfam:LRR_1 103 123 5.2e-2 PFAM
Pfam:LRR_6 123 147 8.1e-4 PFAM
Pfam:LRR_7 124 142 1.5e-1 PFAM
Pfam:LRR_1 125 152 1.1e-3 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008F13Rik C T 2: 156,865,332 P64S probably damaging Het
1810046K07Rik A G 9: 51,291,798 S19P probably damaging Het
4932438A13Rik C T 3: 36,908,231 Q494* probably null Het
Abo C A 2: 26,843,597 D199Y probably damaging Het
Acvr1c A C 2: 58,280,294 V277G probably damaging Het
Adam23 G A 1: 63,545,572 A380T probably benign Het
Art2b A G 7: 101,580,029 V221A probably benign Het
Bcam A G 7: 19,766,715 S153P probably damaging Het
C1qtnf1 G T 11: 118,443,757 G21V probably damaging Het
Car13 T C 3: 14,645,175 I59T probably benign Het
Cog3 T A 14: 75,742,344 E182D probably benign Het
Endou A G 15: 97,712,992 Y404H probably damaging Het
F12 T C 13: 55,420,727 Y373C probably damaging Het
Fam221b T C 4: 43,660,375 T405A probably damaging Het
Fetub A G 16: 22,932,295 R131G probably damaging Het
Foxp2 A T 6: 15,379,768 probably benign Het
Ggt5 T C 10: 75,604,726 V227A probably damaging Het
Gipr A G 7: 19,164,071 S79P probably benign Het
Gm11639 A G 11: 104,720,688 K452R probably benign Het
Gm13089 C G 4: 143,698,144 G243A probably benign Het
Gphn A G 12: 78,412,354 D72G possibly damaging Het
Gzmk A G 13: 113,172,893 S208P probably damaging Het
Itpkc T C 7: 27,208,380 D633G probably damaging Het
Jarid2 T C 13: 44,884,882 probably null Het
Kif21b C A 1: 136,147,845 R237S possibly damaging Het
Lama1 G A 17: 67,791,223 R1805H probably benign Het
Lpin3 C T 2: 160,905,298 P815S probably damaging Het
Lrp1 T A 10: 127,559,998 I2468F possibly damaging Het
Nav1 T C 1: 135,460,737 N1118S probably benign Het
Ncoa3 T A 2: 166,048,464 I90N probably benign Het
Notch3 T C 17: 32,143,428 T1408A probably benign Het
Nwd2 A G 5: 63,805,410 D779G probably benign Het
Obox6 A T 7: 15,834,845 H35Q possibly damaging Het
Pkd1l3 C A 8: 109,624,199 P559T possibly damaging Het
Prex1 T A 2: 166,586,654 I716F probably benign Het
Psap C T 10: 60,295,046 Q219* probably null Het
Shisa5 T A 9: 109,056,040 I126N probably damaging Het
Slc11a1 T C 1: 74,375,772 L21P probably benign Het
Slc4a4 A G 5: 89,046,308 T172A probably damaging Het
Sned1 C T 1: 93,265,047 P352L probably benign Het
Sox4 T C 13: 28,952,144 Y293C probably damaging Het
Srgap3 T A 6: 112,738,997 H654L probably benign Het
Stra6 A T 9: 58,151,883 M510L probably benign Het
Syna C A 5: 134,559,152 M314I probably benign Het
Taf5l A G 8: 124,003,413 L144P probably damaging Het
Tll2 A G 19: 41,113,059 F379L probably benign Het
Traf3ip3 A G 1: 193,175,734 V492A probably benign Het
Uba2 A G 7: 34,151,030 F364S probably damaging Het
Unc50 T A 1: 37,437,242 L161Q probably damaging Het
Ush2a T C 1: 188,550,009 V1907A probably benign Het
Uso1 A T 5: 92,201,133 probably null Het
Utf1 C A 7: 139,944,300 L143I probably damaging Het
Vmn1r158 C T 7: 22,790,718 C22Y probably damaging Het
Vmn1r36 T A 6: 66,716,772 M40L probably benign Het
Vmn2r43 A G 7: 8,255,056 V386A possibly damaging Het
Vps9d1 C A 8: 123,247,039 R335L probably damaging Het
Zbtb26 A G 2: 37,436,335 S230P possibly damaging Het
Zfp74 A T 7: 29,935,144 C380S probably damaging Het
Zfyve1 A C 12: 83,555,614 V469G probably damaging Het
Other mutations in Cep97
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Cep97 APN 16 55924960 splice site probably benign
IGL01142:Cep97 APN 16 55922198 missense probably damaging 1.00
IGL01383:Cep97 APN 16 55911607 missense probably damaging 1.00
IGL01529:Cep97 APN 16 55930618 splice site probably benign
IGL01693:Cep97 APN 16 55930594 missense probably damaging 1.00
IGL01759:Cep97 APN 16 55930573 missense probably damaging 1.00
IGL02085:Cep97 APN 16 55915505 missense probably damaging 1.00
IGL02135:Cep97 APN 16 55922967 missense probably damaging 1.00
IGL02582:Cep97 APN 16 55922176 missense probably damaging 1.00
IGL02631:Cep97 APN 16 55922178 nonsense probably null
IGL02899:Cep97 APN 16 55918540 missense probably damaging 0.98
IGL03086:Cep97 APN 16 55915296 missense probably benign
R0067:Cep97 UTSW 16 55915561 missense possibly damaging 0.96
R0067:Cep97 UTSW 16 55915561 missense possibly damaging 0.96
R0309:Cep97 UTSW 16 55925058 missense probably damaging 0.96
R0504:Cep97 UTSW 16 55905779 missense probably benign 0.00
R0507:Cep97 UTSW 16 55905882 splice site probably benign
R0508:Cep97 UTSW 16 55930606 missense probably benign 0.02
R0658:Cep97 UTSW 16 55914902 missense probably benign 0.09
R1588:Cep97 UTSW 16 55927821 missense probably damaging 1.00
R1619:Cep97 UTSW 16 55927796 missense probably damaging 1.00
R1710:Cep97 UTSW 16 55915022 missense probably damaging 0.99
R1872:Cep97 UTSW 16 55927866 missense probably damaging 1.00
R1878:Cep97 UTSW 16 55905226 missense probably damaging 1.00
R5401:Cep97 UTSW 16 55924952 missense probably benign 0.03
R5520:Cep97 UTSW 16 55915296 missense probably benign
R5627:Cep97 UTSW 16 55924967 critical splice donor site probably null
R5632:Cep97 UTSW 16 55915583 missense probably benign 0.02
R5903:Cep97 UTSW 16 55919526 missense probably damaging 1.00
R5914:Cep97 UTSW 16 55905457 missense probably benign 0.02
R6185:Cep97 UTSW 16 55915092 missense probably benign
R6381:Cep97 UTSW 16 55922171 missense probably damaging 1.00
R7041:Cep97 UTSW 16 55905754 missense probably benign
R7056:Cep97 UTSW 16 55905572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTTATAGAAGTAGACAGTCTC -3'
(R):5'- GGTTACCCCACACAGGTTTTATC -3'

Sequencing Primer
(F):5'- GTAGACAGTCTCACTTTTTAGTTGAC -3'
(R):5'- ACCCCACACAGGTTTTATCTATATG -3'
Posted On2014-06-30