Incidental Mutation 'R1897:Vmn2r87'
ID212060
Institutional Source Beutler Lab
Gene Symbol Vmn2r87
Ensembl Gene ENSMUSG00000091511
Gene Namevomeronasal 2, receptor 87
SynonymsEG625131
MMRRC Submission 039917-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1897 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location130471332-130497379 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 130471960 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 803 (M803K)
Ref Sequence ENSEMBL: ENSMUSP00000129215 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164227]
Predicted Effect probably damaging
Transcript: ENSMUST00000164227
AA Change: M803K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129215
Gene: ENSMUSG00000091511
AA Change: M803K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 77 422 1.8e-27 PFAM
Pfam:NCD3G 508 562 1.8e-19 PFAM
Pfam:7tm_3 595 829 8.8e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218030
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,818 S61G probably damaging Het
Acot12 A G 13: 91,784,397 N504S probably benign Het
Adcy3 C T 12: 4,173,450 probably benign Het
Adcyap1r1 A T 6: 55,479,194 H168L probably damaging Het
Adgrd1 A G 5: 129,129,001 E213G probably benign Het
Aldh1l2 G T 10: 83,502,525 T510K probably damaging Het
Apol7e A T 15: 77,717,894 M231L probably benign Het
Asb1 C A 1: 91,546,925 probably null Het
Atf7ip2 C T 16: 10,211,084 P160L probably damaging Het
Atp8a1 A G 5: 67,738,429 L554P probably damaging Het
Ccdc18 A T 5: 108,196,042 M884L probably benign Het
Ccdc93 A G 1: 121,491,212 I499V probably benign Het
Ccl20 A G 1: 83,117,895 D60G probably damaging Het
Cdhr3 T C 12: 33,045,193 T626A possibly damaging Het
Cep250 A G 2: 155,976,095 E789G probably damaging Het
Cmpk2 T C 12: 26,474,047 L281P probably damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Crocc G A 4: 141,018,736 R1691C probably damaging Het
Csf1 C T 3: 107,748,279 V90M probably damaging Het
Cul2 T G 18: 3,414,164 M86R probably benign Het
Dbndd2 T C 2: 164,488,664 F79S probably damaging Het
Dkk1 G T 19: 30,549,278 N34K possibly damaging Het
Dnah6 T A 6: 73,181,762 L619F probably benign Het
Eif2b5 T C 16: 20,507,037 V588A probably damaging Het
Elf3 A T 1: 135,257,137 Y104N probably damaging Het
Fahd2a T C 2: 127,436,610 D272G probably damaging Het
Fbxw15 A T 9: 109,558,203 C188* probably null Het
Fbxw8 T C 5: 118,128,876 Y174C probably benign Het
Gnl1 C A 17: 35,988,692 P585Q possibly damaging Het
Greb1l T C 18: 10,498,992 S292P probably benign Het
Gsk3b G A 16: 38,217,084 probably null Het
Hcls1 C T 16: 36,962,643 P452L probably damaging Het
Hdlbp A T 1: 93,422,285 probably benign Het
Hecw1 A G 13: 14,377,940 S25P probably damaging Het
Hells T C 19: 38,940,484 V100A probably benign Het
Isl1 C T 13: 116,303,330 E161K probably benign Het
Klra9 G T 6: 130,185,592 N160K possibly damaging Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Mpc1 G A 17: 8,296,878 R134Q possibly damaging Het
Myo5c A T 9: 75,292,241 N1377I probably benign Het
Myrf T C 19: 10,218,232 I607V probably benign Het
Olfr123 T G 17: 37,796,184 S247A probably benign Het
Olfr968 A T 9: 39,772,065 I245K probably damaging Het
Pik3c2b A G 1: 133,066,916 D206G possibly damaging Het
Pipox A G 11: 77,882,742 Y228H probably damaging Het
Pitrm1 T A 13: 6,560,095 V401D possibly damaging Het
Plod1 C T 4: 147,926,200 E265K probably damaging Het
Ptpn21 A T 12: 98,680,405 probably null Het
Qars C T 9: 108,514,083 Q7* probably null Het
Rpap2 T A 5: 107,633,095 V479E possibly damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Rusc2 A G 4: 43,421,749 Y723C probably damaging Het
Ryr2 A T 13: 11,750,932 M1306K probably benign Het
Sesn3 A C 9: 14,308,645 Y110S probably damaging Het
Sgce C T 6: 4,691,511 V319I probably benign Het
Slc15a5 G T 6: 138,079,764 F51L possibly damaging Het
Slit2 T A 5: 48,238,423 C723S probably damaging Het
Sncaip A G 18: 52,894,790 probably null Het
Snx2 T A 18: 53,197,878 D138E probably damaging Het
Spef2 A T 15: 9,729,654 L126* probably null Het
Stam T C 2: 14,129,026 S195P probably damaging Het
Strn T C 17: 78,682,842 I82V probably benign Het
Synj2 T A 17: 6,022,137 C202* probably null Het
Tecpr2 A G 12: 110,933,247 D683G probably benign Het
Tfec A G 6: 16,835,308 V157A probably damaging Het
Tff1 T G 17: 31,164,938 Q28P probably benign Het
Vmn2r86 A G 10: 130,452,445 Y396H probably damaging Het
Vmn2r90 A G 17: 17,733,304 K577E probably damaging Het
Vrk1 T C 12: 106,036,540 probably benign Het
Wdr20 A G 12: 110,793,723 T348A probably benign Het
Other mutations in Vmn2r87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r87 APN 10 130497378 start codon destroyed probably null 1.00
IGL01295:Vmn2r87 APN 10 130472009 missense probably damaging 1.00
IGL01411:Vmn2r87 APN 10 130472560 missense probably benign 0.03
IGL01680:Vmn2r87 APN 10 130479717 nonsense probably null
IGL01822:Vmn2r87 APN 10 130472122 missense probably damaging 1.00
IGL01835:Vmn2r87 APN 10 130479109 missense probably damaging 1.00
IGL01965:Vmn2r87 APN 10 130479055 missense possibly damaging 0.49
IGL02562:Vmn2r87 APN 10 130478644 missense probably damaging 1.00
IGL02665:Vmn2r87 APN 10 130497180 missense probably benign 0.16
IGL03202:Vmn2r87 APN 10 130497222 missense probably benign
FR4304:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4340:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4342:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
FR4589:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
LCD18:Vmn2r87 UTSW 10 130478714 missense probably benign 0.01
R0344:Vmn2r87 UTSW 10 130479937 missense probably damaging 1.00
R0374:Vmn2r87 UTSW 10 130471979 missense probably damaging 1.00
R0384:Vmn2r87 UTSW 10 130471843 missense probably benign
R1144:Vmn2r87 UTSW 10 130476229 splice site probably benign
R1172:Vmn2r87 UTSW 10 130477584 missense probably benign 0.03
R1860:Vmn2r87 UTSW 10 130479886 missense probably benign 0.00
R1866:Vmn2r87 UTSW 10 130472572 missense possibly damaging 0.88
R2360:Vmn2r87 UTSW 10 130479762 missense probably damaging 0.99
R2909:Vmn2r87 UTSW 10 130478996 missense probably damaging 0.99
R3874:Vmn2r87 UTSW 10 130479987 missense possibly damaging 0.62
R4113:Vmn2r87 UTSW 10 130479822 missense probably benign
R4190:Vmn2r87 UTSW 10 130472687 missense probably damaging 1.00
R4197:Vmn2r87 UTSW 10 130479910 missense possibly damaging 0.55
R4201:Vmn2r87 UTSW 10 130472579 missense probably benign 0.03
R4202:Vmn2r87 UTSW 10 130472579 missense probably benign 0.03
R4368:Vmn2r87 UTSW 10 130479807 missense probably benign 0.44
R4485:Vmn2r87 UTSW 10 130479809 nonsense probably null
R4537:Vmn2r87 UTSW 10 130472185 missense probably benign 0.12
R4590:Vmn2r87 UTSW 10 130479145 missense possibly damaging 0.69
R4752:Vmn2r87 UTSW 10 130478467 nonsense probably null
R4873:Vmn2r87 UTSW 10 130472498 missense probably damaging 1.00
R4875:Vmn2r87 UTSW 10 130472498 missense probably damaging 1.00
R4923:Vmn2r87 UTSW 10 130478566 missense probably damaging 0.99
R4970:Vmn2r87 UTSW 10 130478553 missense probably damaging 1.00
R5049:Vmn2r87 UTSW 10 130472429 missense probably damaging 0.96
R5112:Vmn2r87 UTSW 10 130478553 missense probably damaging 1.00
R5187:Vmn2r87 UTSW 10 130497339 missense probably null 0.99
R5618:Vmn2r87 UTSW 10 130479948 missense probably damaging 1.00
R6057:Vmn2r87 UTSW 10 130472357 missense probably benign 0.02
R6220:Vmn2r87 UTSW 10 130479938 missense probably benign 0.01
R6287:Vmn2r87 UTSW 10 130478422 critical splice donor site probably null
R6383:Vmn2r87 UTSW 10 130479000 missense probably damaging 1.00
R6576:Vmn2r87 UTSW 10 130478785 missense probably benign 0.05
R6742:Vmn2r87 UTSW 10 130472527 missense probably damaging 1.00
Z1088:Vmn2r87 UTSW 10 130472314 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTCCACCAAGCTTTGATACTTAG -3'
(R):5'- TCCTGGGATACTTGGGTTCC -3'

Sequencing Primer
(F):5'- ACAGTGTTGTCCTGTTTGTAAGTTC -3'
(R):5'- ATACTTGGGTTCCTTGGCTC -3'
Posted On2014-06-30