Incidental Mutation 'R0124:B020004J07Rik'
List |< first << previous [record 78 of 958] next >> last >|
ID21208
Institutional Source Beutler Lab
Gene Symbol B020004J07Rik
Ensembl Gene ENSMUSG00000035201
Gene NameRIKEN cDNA B020004J07 gene
Synonyms
MMRRC Submission 038409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R0124 (G1)
Quality Score225
Status Validated (trace)
Chromosome4
Chromosomal Location101834969-101844023 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 101835373 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 477 (*477Q)
Ref Sequence ENSEMBL: ENSMUSP00000102532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084386] [ENSMUST00000106919]
Predicted Effect probably null
Transcript: ENSMUST00000084386
AA Change: *477Q
SMART Domains Protein: ENSMUSP00000081421
Gene: ENSMUSG00000035201
AA Change: *477Q

DomainStartEndE-ValueType
SCOP:d1a4ya_ 219 405 2e-10 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106919
AA Change: *477Q
SMART Domains Protein: ENSMUSP00000102532
Gene: ENSMUSG00000035201
AA Change: *477Q

DomainStartEndE-ValueType
SCOP:d1a4ya_ 219 405 2e-10 SMART
Meta Mutation Damage Score 0.6068 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in B020004J07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:B020004J07Rik APN 4 101835532 missense probably benign
IGL01615:B020004J07Rik APN 4 101837004 missense possibly damaging 0.63
IGL01765:B020004J07Rik APN 4 101837852 missense probably benign 0.03
IGL02228:B020004J07Rik APN 4 101836858 missense probably benign 0.03
IGL02276:B020004J07Rik APN 4 101838109 missense possibly damaging 0.89
IGL02548:B020004J07Rik APN 4 101835573 missense probably damaging 0.99
IGL03226:B020004J07Rik APN 4 101835397 missense probably benign 0.00
R0449:B020004J07Rik UTSW 4 101836961 missense probably benign 0.01
R0573:B020004J07Rik UTSW 4 101835414 missense probably damaging 0.96
R1159:B020004J07Rik UTSW 4 101838027 missense possibly damaging 0.54
R1689:B020004J07Rik UTSW 4 101837179 missense possibly damaging 0.63
R1857:B020004J07Rik UTSW 4 101835573 missense probably damaging 1.00
R1861:B020004J07Rik UTSW 4 101836938 missense probably benign
R2570:B020004J07Rik UTSW 4 101837246 missense probably benign 0.01
R3886:B020004J07Rik UTSW 4 101835723 missense probably benign 0.09
R4922:B020004J07Rik UTSW 4 101835532 missense probably benign
R4984:B020004J07Rik UTSW 4 101835599 missense possibly damaging 0.63
R5503:B020004J07Rik UTSW 4 101835802 missense probably benign 0.00
R6230:B020004J07Rik UTSW 4 101837214 missense probably damaging 0.96
R6831:B020004J07Rik UTSW 4 101836897 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- ACTGGTGATCCTGTCCTGATGGAG -3'
(R):5'- GCGATGCATGGCTAACCTAAGCAAG -3'

Sequencing Primer
(F):5'- TCCTGATGGAGGCACATTTAG -3'
(R):5'- CGTCCCTGTAGAGTGCTATAATGAC -3'
Posted On2013-04-11