Incidental Mutation 'R1897:Synj2'
ID212080
Institutional Source Beutler Lab
Gene Symbol Synj2
Ensembl Gene ENSMUSG00000023805
Gene Namesynaptojanin 2
SynonymsSJ2
MMRRC Submission 039917-MU
Accession Numbers

Genbank: NM_001113353.1, NM_001113352.1, NM_011523.2, NM_001113351.1

Is this an essential gene? Probably non essential (E-score: 0.241) question?
Stock #R1897 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location5941280-6044290 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 6022137 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 202 (C202*)
Ref Sequence ENSEMBL: ENSMUSP00000122316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061091] [ENSMUST00000080283] [ENSMUST00000115784] [ENSMUST00000115785] [ENSMUST00000115786] [ENSMUST00000115787] [ENSMUST00000115788] [ENSMUST00000115789] [ENSMUST00000115790] [ENSMUST00000115791] [ENSMUST00000126881] [ENSMUST00000134767] [ENSMUST00000142409] [ENSMUST00000146009] [ENSMUST00000154114]
Predicted Effect probably null
Transcript: ENSMUST00000061091
AA Change: C639*
SMART Domains Protein: ENSMUSP00000060382
Gene: ENSMUSG00000023805
AA Change: C639*

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 2.5e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000080283
AA Change: C724*
SMART Domains Protein: ENSMUSP00000079164
Gene: ENSMUSG00000023805
AA Change: C724*

DomainStartEndE-ValueType
Pfam:Syja_N 60 348 5.5e-78 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1167 1179 N/A INTRINSIC
low complexity region 1217 1234 N/A INTRINSIC
low complexity region 1263 1277 N/A INTRINSIC
low complexity region 1293 1306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115784
SMART Domains Protein: ENSMUSP00000111450
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
PDB:3LWT|X 9 171 3e-12 PDB
Blast:IPPc 163 192 2e-6 BLAST
IPPc 212 554 3.72e-128 SMART
DUF1866 547 692 1.04e-73 SMART
low complexity region 695 709 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115785
AA Change: C408*
SMART Domains Protein: ENSMUSP00000111451
Gene: ENSMUSG00000023805
AA Change: C408*

DomainStartEndE-ValueType
PDB:3LWT|X 9 171 4e-12 PDB
Blast:IPPc 163 192 2e-6 BLAST
IPPc 212 554 3.72e-128 SMART
DUF1866 547 692 1.04e-73 SMART
low complexity region 695 709 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
low complexity region 851 863 N/A INTRINSIC
low complexity region 901 918 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
low complexity region 977 990 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115786
SMART Domains Protein: ENSMUSP00000111452
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 5.3e-29 PFAM
Blast:IPPc 239 268 1e-6 BLAST
IPPc 288 525 6e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115787
SMART Domains Protein: ENSMUSP00000111453
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 5.7e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
DUF1866 623 768 1.04e-73 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 810 821 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
low complexity region 977 994 N/A INTRINSIC
low complexity region 1023 1037 N/A INTRINSIC
low complexity region 1053 1066 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115788
SMART Domains Protein: ENSMUSP00000111454
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 4.8e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
DUF1866 623 768 1.04e-73 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 810 821 N/A INTRINSIC
low complexity region 927 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115789
SMART Domains Protein: ENSMUSP00000111455
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 187 2.3e-60 PFAM
Blast:IPPc 318 347 2e-6 BLAST
IPPc 367 709 3.72e-128 SMART
DUF1866 702 847 1.04e-73 SMART
low complexity region 850 864 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
low complexity region 1056 1073 N/A INTRINSIC
low complexity region 1102 1116 N/A INTRINSIC
low complexity region 1132 1145 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115790
AA Change: C639*
SMART Domains Protein: ENSMUSP00000111456
Gene: ENSMUSG00000023805
AA Change: C639*

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 3e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1223 1237 N/A INTRINSIC
low complexity region 1253 1266 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115791
AA Change: C724*
SMART Domains Protein: ENSMUSP00000111457
Gene: ENSMUSG00000023805
AA Change: C724*

DomainStartEndE-ValueType
Pfam:Syja_N 61 343 8.5e-67 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1262 1279 N/A INTRINSIC
low complexity region 1308 1322 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126881
SMART Domains Protein: ENSMUSP00000115371
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
DUF1866 16 161 1.04e-73 SMART
low complexity region 164 178 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134767
Predicted Effect probably null
Transcript: ENSMUST00000142409
AA Change: C484*
SMART Domains Protein: ENSMUSP00000120006
Gene: ENSMUSG00000023805
AA Change: C484*

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 2.5e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146009
AA Change: C724*
SMART Domains Protein: ENSMUSP00000122381
Gene: ENSMUSG00000023805
AA Change: C724*

DomainStartEndE-ValueType
Pfam:Syja_N 60 348 3.6e-78 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154114
AA Change: C202*
SMART Domains Protein: ENSMUSP00000122316
Gene: ENSMUSG00000023805
AA Change: C202*

DomainStartEndE-ValueType
IPPc 6 348 3.72e-128 SMART
DUF1866 341 486 1.04e-73 SMART
low complexity region 489 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232567
Meta Mutation Damage Score 0.584 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the inositol-polyphosphate 5-phosphatase family. The encoded protein interacts with the ras-related C3 botulinum toxin substrate 1, which causes translocation of the encoded protein to the plasma membrane where it inhibits clathrin-mediated endocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss and cochlear hair cell degeneration associated with fusion of stereocilia followed by total loss of hair bundles and cochlear ganglion degeneration. No vestibular dysfunction or other behavioral deficits are observed. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,818 S61G probably damaging Het
Acot12 A G 13: 91,784,397 N504S probably benign Het
Adcy3 C T 12: 4,173,450 probably benign Het
Adcyap1r1 A T 6: 55,479,194 H168L probably damaging Het
Adgrd1 A G 5: 129,129,001 E213G probably benign Het
Aldh1l2 G T 10: 83,502,525 T510K probably damaging Het
Apol7e A T 15: 77,717,894 M231L probably benign Het
Asb1 C A 1: 91,546,925 probably null Het
Atf7ip2 C T 16: 10,211,084 P160L probably damaging Het
Atp8a1 A G 5: 67,738,429 L554P probably damaging Het
Ccdc18 A T 5: 108,196,042 M884L probably benign Het
Ccdc93 A G 1: 121,491,212 I499V probably benign Het
Ccl20 A G 1: 83,117,895 D60G probably damaging Het
Cdhr3 T C 12: 33,045,193 T626A possibly damaging Het
Cep250 A G 2: 155,976,095 E789G probably damaging Het
Cmpk2 T C 12: 26,474,047 L281P probably damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Crocc G A 4: 141,018,736 R1691C probably damaging Het
Csf1 C T 3: 107,748,279 V90M probably damaging Het
Cul2 T G 18: 3,414,164 M86R probably benign Het
Dbndd2 T C 2: 164,488,664 F79S probably damaging Het
Dkk1 G T 19: 30,549,278 N34K possibly damaging Het
Dnah6 T A 6: 73,181,762 L619F probably benign Het
Eif2b5 T C 16: 20,507,037 V588A probably damaging Het
Elf3 A T 1: 135,257,137 Y104N probably damaging Het
Fahd2a T C 2: 127,436,610 D272G probably damaging Het
Fbxw15 A T 9: 109,558,203 C188* probably null Het
Fbxw8 T C 5: 118,128,876 Y174C probably benign Het
Gnl1 C A 17: 35,988,692 P585Q possibly damaging Het
Greb1l T C 18: 10,498,992 S292P probably benign Het
Gsk3b G A 16: 38,217,084 probably null Het
Hcls1 C T 16: 36,962,643 P452L probably damaging Het
Hdlbp A T 1: 93,422,285 probably benign Het
Hecw1 A G 13: 14,377,940 S25P probably damaging Het
Hells T C 19: 38,940,484 V100A probably benign Het
Isl1 C T 13: 116,303,330 E161K probably benign Het
Klra9 G T 6: 130,185,592 N160K possibly damaging Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Mpc1 G A 17: 8,296,878 R134Q possibly damaging Het
Myo5c A T 9: 75,292,241 N1377I probably benign Het
Myrf T C 19: 10,218,232 I607V probably benign Het
Olfr123 T G 17: 37,796,184 S247A probably benign Het
Olfr968 A T 9: 39,772,065 I245K probably damaging Het
Pik3c2b A G 1: 133,066,916 D206G possibly damaging Het
Pipox A G 11: 77,882,742 Y228H probably damaging Het
Pitrm1 T A 13: 6,560,095 V401D possibly damaging Het
Plod1 C T 4: 147,926,200 E265K probably damaging Het
Ptpn21 A T 12: 98,680,405 probably null Het
Qars C T 9: 108,514,083 Q7* probably null Het
Rpap2 T A 5: 107,633,095 V479E possibly damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Rusc2 A G 4: 43,421,749 Y723C probably damaging Het
Ryr2 A T 13: 11,750,932 M1306K probably benign Het
Sesn3 A C 9: 14,308,645 Y110S probably damaging Het
Sgce C T 6: 4,691,511 V319I probably benign Het
Slc15a5 G T 6: 138,079,764 F51L possibly damaging Het
Slit2 T A 5: 48,238,423 C723S probably damaging Het
Sncaip A G 18: 52,894,790 probably null Het
Snx2 T A 18: 53,197,878 D138E probably damaging Het
Spef2 A T 15: 9,729,654 L126* probably null Het
Stam T C 2: 14,129,026 S195P probably damaging Het
Strn T C 17: 78,682,842 I82V probably benign Het
Tecpr2 A G 12: 110,933,247 D683G probably benign Het
Tfec A G 6: 16,835,308 V157A probably damaging Het
Tff1 T G 17: 31,164,938 Q28P probably benign Het
Vmn2r86 A G 10: 130,452,445 Y396H probably damaging Het
Vmn2r87 A T 10: 130,471,960 M803K probably damaging Het
Vmn2r90 A G 17: 17,733,304 K577E probably damaging Het
Vrk1 T C 12: 106,036,540 probably benign Het
Wdr20 A G 12: 110,793,723 T348A probably benign Het
Other mutations in Synj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Synj2 APN 17 6037926 missense possibly damaging 0.48
IGL01399:Synj2 APN 17 6009771 missense probably damaging 1.00
IGL01793:Synj2 APN 17 6027225 nonsense probably null
IGL01793:Synj2 APN 17 6038046 missense probably benign 0.01
IGL02096:Synj2 APN 17 5990353 missense probably damaging 1.00
IGL02115:Synj2 APN 17 6017590 missense probably damaging 1.00
IGL02222:Synj2 APN 17 6037480 missense probably benign 0.04
IGL02478:Synj2 APN 17 6037924 missense probably benign 0.00
IGL02634:Synj2 APN 17 6029760 missense probably damaging 1.00
IGL02652:Synj2 APN 17 6017593 missense probably damaging 1.00
IGL02681:Synj2 APN 17 5990336 missense probably damaging 1.00
IGL02719:Synj2 APN 17 5996917 missense probably benign 0.02
IGL03253:Synj2 APN 17 6003159 unclassified probably null
IGL03365:Synj2 APN 17 6019404 missense probably damaging 1.00
I2288:Synj2 UTSW 17 6022267 splice site probably benign
I2289:Synj2 UTSW 17 6022267 splice site probably benign
R0389:Synj2 UTSW 17 6029783 missense probably benign 0.35
R0433:Synj2 UTSW 17 6033848 missense probably damaging 1.00
R0530:Synj2 UTSW 17 6008105 missense possibly damaging 0.88
R0539:Synj2 UTSW 17 5996888 start codon destroyed probably null 0.63
R0556:Synj2 UTSW 17 6037955 nonsense probably null
R1263:Synj2 UTSW 17 6019359 missense probably damaging 0.99
R1443:Synj2 UTSW 17 6023665 missense probably damaging 0.99
R1450:Synj2 UTSW 17 6027324 splice site probably benign
R1532:Synj2 UTSW 17 6033919 missense probably benign 0.00
R1542:Synj2 UTSW 17 6025017 missense probably benign 0.01
R1809:Synj2 UTSW 17 6026551 missense possibly damaging 0.95
R1875:Synj2 UTSW 17 6028550 missense possibly damaging 0.69
R1928:Synj2 UTSW 17 5990267 missense probably damaging 0.99
R2008:Synj2 UTSW 17 5996946 missense probably damaging 1.00
R2060:Synj2 UTSW 17 6037480 missense probably benign 0.04
R2109:Synj2 UTSW 17 6013691 missense probably benign 0.00
R2332:Synj2 UTSW 17 6023794 missense probably damaging 0.99
R2413:Synj2 UTSW 17 6028574 missense probably damaging 1.00
R3684:Synj2 UTSW 17 6028443 missense probably damaging 0.97
R4111:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4113:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4654:Synj2 UTSW 17 6013538 missense probably damaging 1.00
R4797:Synj2 UTSW 17 6033888 missense probably damaging 1.00
R4812:Synj2 UTSW 17 6010664 missense probably damaging 1.00
R4873:Synj2 UTSW 17 5988068 intron probably benign
R4875:Synj2 UTSW 17 5988068 intron probably benign
R5110:Synj2 UTSW 17 6037715 missense probably benign 0.06
R5205:Synj2 UTSW 17 5941518 missense probably damaging 1.00
R5504:Synj2 UTSW 17 6036475 missense possibly damaging 0.85
R5593:Synj2 UTSW 17 6038115 makesense probably null
R5690:Synj2 UTSW 17 6035527 missense probably benign 0.00
R5870:Synj2 UTSW 17 6037853 missense probably benign 0.00
R6084:Synj2 UTSW 17 6017614 missense probably damaging 0.98
R6084:Synj2 UTSW 17 6038098 missense probably damaging 1.00
R6158:Synj2 UTSW 17 5986212 missense probably benign 0.00
R6159:Synj2 UTSW 17 5986052 missense probably damaging 1.00
R6160:Synj2 UTSW 17 6008061 missense possibly damaging 0.92
R6278:Synj2 UTSW 17 5975874 missense probably damaging 1.00
R6406:Synj2 UTSW 17 6019571 intron probably benign
R6531:Synj2 UTSW 17 6033839 missense probably damaging 1.00
R6729:Synj2 UTSW 17 5986014 start codon destroyed probably null 1.00
R6774:Synj2 UTSW 17 6038015 missense possibly damaging 0.87
R6792:Synj2 UTSW 17 5990290 missense probably benign 0.01
R6844:Synj2 UTSW 17 5975806 missense probably damaging 0.96
R6865:Synj2 UTSW 17 6017569 nonsense probably null
R7178:Synj2 UTSW 17 6026479 missense possibly damaging 0.95
R7286:Synj2 UTSW 17 6037945 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACATGGGGCCCTATTTCAAATC -3'
(R):5'- GTTAGTAGAGAGCCCTCCACAC -3'

Sequencing Primer
(F):5'- TGAGAAGCAAAGTATGTAAGGATTTC -3'
(R):5'- CTGTAACAGTTACCAAAGACATCTG -3'
Posted On2014-06-30