Incidental Mutation 'R1897:Hells'
ID212093
Institutional Source Beutler Lab
Gene Symbol Hells
Ensembl Gene ENSMUSG00000025001
Gene Namehelicase, lymphoid specific
SynonymsYFK8, LSH, proliferation-associated SNF2-like, PASG, Lysh, E130115I21Rik
MMRRC Submission 039917-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1897 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location38930915-38971051 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38940484 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 100 (V100A)
Ref Sequence ENSEMBL: ENSMUSP00000116710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025965] [ENSMUST00000145051]
Predicted Effect probably benign
Transcript: ENSMUST00000025965
AA Change: V100A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025965
Gene: ENSMUSG00000025001
AA Change: V100A

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Blast:DEXDc 40 144 4e-22 BLAST
DEXDc 202 394 7.04e-31 SMART
HELICc 612 695 5.6e-25 SMART
low complexity region 775 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127968
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128949
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138292
Predicted Effect probably benign
Transcript: ENSMUST00000145051
AA Change: V100A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116710
Gene: ENSMUSG00000025001
AA Change: V100A

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Blast:DEXDc 40 144 5e-24 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155465
Meta Mutation Damage Score 0.1332 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.8%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lymphoid-specific helicase. Other helicases function in processes involving DNA strand separation, including replication, repair, recombination, and transcription. This protein is thought to be involved with cellular proliferation and may play a role in leukemogenesis. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show DNA hypomethylation, delayed growth, multiorgan and skeletal defects, premature graying, alopecia, low fat deposition, kyphosis, cachexia and early death. Homozygotes for another null allele show neonatal death, low birth weight, lymphoid defects and renal lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd6 A G 1: 155,558,818 S61G probably damaging Het
Acot12 A G 13: 91,784,397 N504S probably benign Het
Adcy3 C T 12: 4,173,450 probably benign Het
Adcyap1r1 A T 6: 55,479,194 H168L probably damaging Het
Adgrd1 A G 5: 129,129,001 E213G probably benign Het
Aldh1l2 G T 10: 83,502,525 T510K probably damaging Het
Apol7e A T 15: 77,717,894 M231L probably benign Het
Asb1 C A 1: 91,546,925 probably null Het
Atf7ip2 C T 16: 10,211,084 P160L probably damaging Het
Atp8a1 A G 5: 67,738,429 L554P probably damaging Het
Ccdc18 A T 5: 108,196,042 M884L probably benign Het
Ccdc93 A G 1: 121,491,212 I499V probably benign Het
Ccl20 A G 1: 83,117,895 D60G probably damaging Het
Cdhr3 T C 12: 33,045,193 T626A possibly damaging Het
Cep250 A G 2: 155,976,095 E789G probably damaging Het
Cmpk2 T C 12: 26,474,047 L281P probably damaging Het
Col6a6 A T 9: 105,785,744 M198K possibly damaging Het
Crocc G A 4: 141,018,736 R1691C probably damaging Het
Csf1 C T 3: 107,748,279 V90M probably damaging Het
Cul2 T G 18: 3,414,164 M86R probably benign Het
Dbndd2 T C 2: 164,488,664 F79S probably damaging Het
Dkk1 G T 19: 30,549,278 N34K possibly damaging Het
Dnah6 T A 6: 73,181,762 L619F probably benign Het
Eif2b5 T C 16: 20,507,037 V588A probably damaging Het
Elf3 A T 1: 135,257,137 Y104N probably damaging Het
Fahd2a T C 2: 127,436,610 D272G probably damaging Het
Fbxw15 A T 9: 109,558,203 C188* probably null Het
Fbxw8 T C 5: 118,128,876 Y174C probably benign Het
Gnl1 C A 17: 35,988,692 P585Q possibly damaging Het
Greb1l T C 18: 10,498,992 S292P probably benign Het
Gsk3b G A 16: 38,217,084 probably null Het
Hcls1 C T 16: 36,962,643 P452L probably damaging Het
Hdlbp A T 1: 93,422,285 probably benign Het
Hecw1 A G 13: 14,377,940 S25P probably damaging Het
Isl1 C T 13: 116,303,330 E161K probably benign Het
Klra9 G T 6: 130,185,592 N160K possibly damaging Het
Lama4 T C 10: 39,060,186 V619A probably damaging Het
Mpc1 G A 17: 8,296,878 R134Q possibly damaging Het
Myo5c A T 9: 75,292,241 N1377I probably benign Het
Myrf T C 19: 10,218,232 I607V probably benign Het
Olfr123 T G 17: 37,796,184 S247A probably benign Het
Olfr968 A T 9: 39,772,065 I245K probably damaging Het
Pik3c2b A G 1: 133,066,916 D206G possibly damaging Het
Pipox A G 11: 77,882,742 Y228H probably damaging Het
Pitrm1 T A 13: 6,560,095 V401D possibly damaging Het
Plod1 C T 4: 147,926,200 E265K probably damaging Het
Ptpn21 A T 12: 98,680,405 probably null Het
Qars C T 9: 108,514,083 Q7* probably null Het
Rpap2 T A 5: 107,633,095 V479E possibly damaging Het
Rsf1 G A 7: 97,579,910 probably benign Het
Rusc2 A G 4: 43,421,749 Y723C probably damaging Het
Ryr2 A T 13: 11,750,932 M1306K probably benign Het
Sesn3 A C 9: 14,308,645 Y110S probably damaging Het
Sgce C T 6: 4,691,511 V319I probably benign Het
Slc15a5 G T 6: 138,079,764 F51L possibly damaging Het
Slit2 T A 5: 48,238,423 C723S probably damaging Het
Sncaip A G 18: 52,894,790 probably null Het
Snx2 T A 18: 53,197,878 D138E probably damaging Het
Spef2 A T 15: 9,729,654 L126* probably null Het
Stam T C 2: 14,129,026 S195P probably damaging Het
Strn T C 17: 78,682,842 I82V probably benign Het
Synj2 T A 17: 6,022,137 C202* probably null Het
Tecpr2 A G 12: 110,933,247 D683G probably benign Het
Tfec A G 6: 16,835,308 V157A probably damaging Het
Tff1 T G 17: 31,164,938 Q28P probably benign Het
Vmn2r86 A G 10: 130,452,445 Y396H probably damaging Het
Vmn2r87 A T 10: 130,471,960 M803K probably damaging Het
Vmn2r90 A G 17: 17,733,304 K577E probably damaging Het
Vrk1 T C 12: 106,036,540 probably benign Het
Wdr20 A G 12: 110,793,723 T348A probably benign Het
Other mutations in Hells
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02416:Hells APN 19 38964627 missense probably benign
IGL02639:Hells APN 19 38938429 missense probably damaging 0.99
cerberus UTSW 19 38954800 missense probably benign 0.00
charon UTSW 19 38954810 missense probably benign 0.15
intentions UTSW 19 38957199 missense probably damaging 1.00
purgatory UTSW 19 38940635 missense probably benign 0.08
R0543:Hells UTSW 19 38967750 missense probably benign
R1432:Hells UTSW 19 38957184 splice site probably null
R1515:Hells UTSW 19 38967765 missense probably damaging 1.00
R1646:Hells UTSW 19 38967783 missense probably benign 0.19
R1779:Hells UTSW 19 38946842 missense probably benign 0.43
R1851:Hells UTSW 19 38959676 missense probably null 1.00
R2040:Hells UTSW 19 38955030 missense probably damaging 0.98
R2571:Hells UTSW 19 38959733 missense possibly damaging 0.67
R4475:Hells UTSW 19 38945529 missense probably damaging 1.00
R4763:Hells UTSW 19 38957199 missense probably damaging 1.00
R4948:Hells UTSW 19 38935522 missense probably damaging 1.00
R5087:Hells UTSW 19 38943745 missense probably benign
R5517:Hells UTSW 19 38954800 missense probably benign 0.00
R5538:Hells UTSW 19 38953652 missense probably benign 0.00
R6107:Hells UTSW 19 38953649 missense probably benign 0.00
R6337:Hells UTSW 19 38954810 missense probably benign 0.15
R6577:Hells UTSW 19 38931465 nonsense probably null
R6618:Hells UTSW 19 38957084 missense probably benign 0.17
R6647:Hells UTSW 19 38931504 missense probably benign 0.01
R6869:Hells UTSW 19 38940635 missense probably benign 0.08
R7471:Hells UTSW 19 38957057 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTATGTTTGGGCGATCATGGA -3'
(R):5'- CCTCTTTTGACATGACCTCTGAAAT -3'

Sequencing Primer
(F):5'- GGCACTAGATGTTCTTCCAGAGAC -3'
(R):5'- TTAATAGCAGCTAAAAACAGAAG -3'
Posted On2014-06-30