Incidental Mutation 'R1898:Crx'
ID 212117
Institutional Source Beutler Lab
Gene Symbol Crx
Ensembl Gene ENSMUSG00000041578
Gene Name cone-rod homeobox
Synonyms Crx1
MMRRC Submission 039918-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.375) question?
Stock # R1898 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 15599872-15613880 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 15602148 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 177 (P177S)
Ref Sequence ENSEMBL: ENSMUSP00000134400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044434] [ENSMUST00000132563] [ENSMUST00000172758] [ENSMUST00000174318]
AlphaFold O54751
Predicted Effect probably damaging
Transcript: ENSMUST00000044434
AA Change: P153S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043436
Gene: ENSMUSG00000041578
AA Change: P153S

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
Pfam:TF_Otx 164 250 1.1e-15 PFAM
internal_repeat_1 260 278 1.41e-5 PROSPERO
internal_repeat_1 279 296 1.41e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000132563
AA Change: P153S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133833
Gene: ENSMUSG00000041578
AA Change: P153S

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
low complexity region 196 207 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165905
AA Change: P177S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126642
Gene: ENSMUSG00000041578
AA Change: P177S

DomainStartEndE-ValueType
HOX 63 125 2.39e-24 SMART
low complexity region 163 177 N/A INTRINSIC
Pfam:TF_Otx 188 273 1.9e-17 PFAM
internal_repeat_1 284 302 2.45e-5 PROSPERO
internal_repeat_1 303 320 2.45e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000172758
SMART Domains Protein: ENSMUSP00000134463
Gene: ENSMUSG00000041578

DomainStartEndE-ValueType
HOX 39 74 6.07e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174318
AA Change: P177S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134400
Gene: ENSMUSG00000041578
AA Change: P177S

DomainStartEndE-ValueType
HOX 39 101 2.39e-24 SMART
low complexity region 139 153 N/A INTRINSIC
Pfam:TF_Otx 164 250 1.1e-15 PFAM
internal_repeat_1 260 278 1.41e-5 PROSPERO
internal_repeat_1 279 296 1.41e-5 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174358
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a photoreceptor-specific transcription factor which plays a role in the differentiation of photoreceptor cells. This homeodomain protein is necessary for the maintenance of normal cone and rod function. Mutations in this gene are associated with photoreceptor degeneration, Leber congenital amaurosis type III and the autosomal dominant cone-rod dystrophy 2. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit a lack of photoreceptor outer segments and rod and cone activity, reduced expression of several photoreceptor- and pineal-specific genes, and altered circadian behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C A 4: 53,071,977 (GRCm39) R1195L probably benign Het
Abca14 A G 7: 119,850,392 (GRCm39) Y748C probably damaging Het
Abca6 A G 11: 110,099,625 (GRCm39) F974S probably damaging Het
Acyp1 T C 12: 85,335,114 (GRCm39) K2E probably benign Het
Ahcy T A 2: 154,904,173 (GRCm39) S355C probably benign Het
AI182371 A G 2: 34,990,661 (GRCm39) V12A probably damaging Het
Ankrd36 T C 11: 5,525,683 (GRCm39) I215T probably benign Het
Aox1 C T 1: 58,117,601 (GRCm39) R828C probably damaging Het
Atp1a4 T A 1: 172,062,615 (GRCm39) I631F probably damaging Het
Brd10 T C 19: 29,712,532 (GRCm39) N789S possibly damaging Het
Brinp3 T G 1: 146,776,987 (GRCm39) V478G possibly damaging Het
Cadm2 G A 16: 66,612,271 (GRCm39) S106L probably damaging Het
Celf2 C T 2: 6,608,975 (GRCm39) V95M probably damaging Het
Chka A T 19: 3,942,205 (GRCm39) E404D probably damaging Het
Clec5a A C 6: 40,558,870 (GRCm39) V72G probably benign Het
Cnn1 T C 9: 22,012,560 (GRCm39) probably null Het
Coq6 A G 12: 84,413,737 (GRCm39) E89G probably benign Het
Cpne6 A T 14: 55,754,485 (GRCm39) I538F possibly damaging Het
Cysltr2 G T 14: 73,266,973 (GRCm39) P246T probably damaging Het
Decr1 A G 4: 15,929,801 (GRCm39) I164T probably damaging Het
Dmtf1 A T 5: 9,178,091 (GRCm39) V315E probably damaging Het
Dnah7b A G 1: 46,275,874 (GRCm39) N2587S probably benign Het
E2f6 C A 12: 16,874,581 (GRCm39) T221K probably benign Het
Fat3 T G 9: 15,871,426 (GRCm39) D3655A probably damaging Het
Fbxw28 G A 9: 109,152,452 (GRCm39) T384I probably benign Het
Fes T A 7: 80,029,659 (GRCm39) I608F probably damaging Het
Flnc G A 6: 29,438,665 (GRCm39) W186* probably null Het
Gabrb2 A G 11: 42,484,659 (GRCm39) K239E possibly damaging Het
Gen1 T C 12: 11,291,609 (GRCm39) R727G probably benign Het
Glb1 T A 9: 114,253,103 (GRCm39) V184E probably damaging Het
Gngt1 A T 6: 3,996,724 (GRCm39) I57F possibly damaging Het
Ice1 T C 13: 70,750,426 (GRCm39) I87V possibly damaging Het
Itih1 A G 14: 30,654,244 (GRCm39) Y674H probably benign Het
Itsn1 T A 16: 91,696,468 (GRCm39) C24S probably damaging Het
Loxl1 A G 9: 58,204,961 (GRCm39) V418A probably damaging Het
Myh10 A G 11: 68,662,732 (GRCm39) N595S probably damaging Het
Myo5c C T 9: 75,204,908 (GRCm39) T1587I probably damaging Het
Npat T A 9: 53,474,937 (GRCm39) F910I probably damaging Het
Nradd T C 9: 110,450,676 (GRCm39) Y167C probably damaging Het
Nt5dc1 T C 10: 34,189,631 (GRCm39) E352G probably benign Het
Numa1 T C 7: 101,641,927 (GRCm39) probably null Het
Odc1 T A 12: 17,598,842 (GRCm39) S241T probably damaging Het
Or11g2 A T 14: 50,856,231 (GRCm39) D184V probably damaging Het
Or14j7 A T 17: 38,234,516 (GRCm39) N20Y possibly damaging Het
Pcnx3 T C 19: 5,722,615 (GRCm39) D951G probably damaging Het
Pigg T C 5: 108,484,408 (GRCm39) F685L probably benign Het
Pnpla7 T A 2: 24,943,796 (GRCm39) probably benign Het
Pramel16 C T 4: 143,677,298 (GRCm39) V94M probably damaging Het
Rcsd1 C T 1: 165,486,998 (GRCm39) A72T probably benign Het
Rp1l1 A T 14: 64,269,039 (GRCm39) T1542S probably benign Het
Sct A T 7: 140,858,761 (GRCm39) L57Q probably damaging Het
Serpinb3b T C 1: 107,082,317 (GRCm39) S316G possibly damaging Het
Shprh T C 10: 11,062,613 (GRCm39) L1240S probably damaging Het
Slc4a1 C T 11: 102,241,133 (GRCm39) E924K probably damaging Het
Sp7 A T 15: 102,267,453 (GRCm39) Y118N possibly damaging Het
Srebf2 A G 15: 82,087,936 (GRCm39) T219A probably damaging Het
Tenm3 G T 8: 48,763,796 (GRCm39) P753T probably damaging Het
Tonsl A T 15: 76,523,053 (GRCm39) probably null Het
Trio A T 15: 27,742,466 (GRCm39) S2675T possibly damaging Het
Tspan12 T C 6: 21,795,693 (GRCm39) T166A probably damaging Het
Ttll4 A G 1: 74,736,641 (GRCm39) D1122G probably benign Het
Vmn1r77 G A 7: 11,775,550 (GRCm39) A41T probably damaging Het
Xpo7 A T 14: 70,933,064 (GRCm39) F276Y probably benign Het
Zdhhc1 A T 8: 106,205,378 (GRCm39) probably null Het
Zfp319 C A 8: 96,055,417 (GRCm39) C262F probably damaging Het
Zfp442 C T 2: 150,250,582 (GRCm39) C383Y probably damaging Het
Zfp57 G T 17: 37,320,650 (GRCm39) R168L possibly damaging Het
Other mutations in Crx
AlleleSourceChrCoordTypePredicted EffectPPH Score
Typhlotic UTSW 7 15,602,032 (GRCm39) nonsense probably null
R0437:Crx UTSW 7 15,605,071 (GRCm39) nonsense probably null
R0729:Crx UTSW 7 15,605,058 (GRCm39) splice site probably benign
R1601:Crx UTSW 7 15,601,736 (GRCm39) splice site probably null
R1933:Crx UTSW 7 15,602,301 (GRCm39) nonsense probably null
R1988:Crx UTSW 7 15,603,272 (GRCm39) missense possibly damaging 0.95
R5272:Crx UTSW 7 15,602,210 (GRCm39) missense probably damaging 0.99
R5326:Crx UTSW 7 15,602,262 (GRCm39) missense probably damaging 1.00
R5542:Crx UTSW 7 15,602,262 (GRCm39) missense probably damaging 1.00
R6134:Crx UTSW 7 15,602,032 (GRCm39) nonsense probably null
R7313:Crx UTSW 7 15,601,857 (GRCm39) missense probably damaging 1.00
R8458:Crx UTSW 7 15,602,031 (GRCm39) missense possibly damaging 0.56
R9619:Crx UTSW 7 15,602,185 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACCCACTGAAATAGGAACTTGG -3'
(R):5'- CTGGTTCAAGAATCGTAGGGC -3'

Sequencing Primer
(F):5'- CCCACTGAAATAGGAACTTGGAGATG -3'
(R):5'- CACAGACCAAGGCTCGT -3'
Posted On 2014-06-30