Incidental Mutation 'R1898:Gen1'
ID212146
Institutional Source Beutler Lab
Gene Symbol Gen1
Ensembl Gene ENSMUSG00000051235
Gene NameGEN1, Holliday junction 5' flap endonuclease
Synonyms5830483C08Rik
MMRRC Submission 039918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1898 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location11238920-11265801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11241608 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 727 (R727G)
Ref Sequence ENSEMBL: ENSMUSP00000151310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166117] [ENSMUST00000218487] [ENSMUST00000218547]
Predicted Effect probably benign
Transcript: ENSMUST00000166117
AA Change: R792G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132098
Gene: ENSMUSG00000051235
AA Change: R792G

DomainStartEndE-ValueType
XPGN 1 96 9.13e-22 SMART
XPGI 122 193 5.32e-23 SMART
HhH2 195 229 2.87e-5 SMART
low complexity region 704 713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218487
AA Change: R727G

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000218547
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rad2/xeroderma pigmentosum group G nuclease family, whose members are characterized by N-terminal and internal xeroderma pigmentosum group G nuclease domains followed by helix-hairpin-helix domains and disordered C-terminal domains. The protein encoded by this gene is involved in resolution of Holliday junctions, which are intermediate four-way structures that covalently link DNA during homologous recombination and double-strand break repair. The protein resolves Holliday junctions by creating dual incisions across the junction to produce nicked duplex products that can be ligated. In addition, this protein has been found to localize to centrosomes where it has been implicated in regulation of centrosome integrity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,132 N789S possibly damaging Het
Abca1 C A 4: 53,071,977 R1195L probably benign Het
Abca14 A G 7: 120,251,169 Y748C probably damaging Het
Abca6 A G 11: 110,208,799 F974S probably damaging Het
Acyp1 T C 12: 85,288,340 K2E probably benign Het
Ahcy T A 2: 155,062,253 S355C probably benign Het
AI182371 A G 2: 35,100,649 V12A probably damaging Het
Ankrd36 T C 11: 5,575,683 I215T probably benign Het
Aox1 C T 1: 58,078,442 R828C probably damaging Het
Atp1a4 T A 1: 172,235,048 I631F probably damaging Het
Brinp3 T G 1: 146,901,249 V478G possibly damaging Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Celf2 C T 2: 6,604,164 V95M probably damaging Het
Chka A T 19: 3,892,205 E404D probably damaging Het
Clec5a A C 6: 40,581,936 V72G probably benign Het
Cnn1 T C 9: 22,101,264 probably null Het
Coq6 A G 12: 84,366,963 E89G probably benign Het
Cpne6 A T 14: 55,517,028 I538F possibly damaging Het
Crx G A 7: 15,868,223 P177S probably damaging Het
Cysltr2 G T 14: 73,029,533 P246T probably damaging Het
Decr1 A G 4: 15,929,801 I164T probably damaging Het
Dmtf1 A T 5: 9,128,091 V315E probably damaging Het
Dnah7b A G 1: 46,236,714 N2587S probably benign Het
E2f6 C A 12: 16,824,580 T221K probably benign Het
Fat3 T G 9: 15,960,130 D3655A probably damaging Het
Fbxw28 G A 9: 109,323,384 T384I probably benign Het
Fes T A 7: 80,379,911 I608F probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Gabrb2 A G 11: 42,593,832 K239E possibly damaging Het
Glb1 T A 9: 114,424,035 V184E probably damaging Het
Gngt1 A T 6: 3,996,724 I57F possibly damaging Het
Ice1 T C 13: 70,602,307 I87V possibly damaging Het
Itih1 A G 14: 30,932,287 Y674H probably benign Het
Itsn1 T A 16: 91,899,580 C24S probably damaging Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Myh10 A G 11: 68,771,906 N595S probably damaging Het
Myo5c C T 9: 75,297,626 T1587I probably damaging Het
Npat T A 9: 53,563,637 F910I probably damaging Het
Nradd T C 9: 110,621,608 Y167C probably damaging Het
Nt5dc1 T C 10: 34,313,635 E352G probably benign Het
Numa1 T C 7: 101,992,720 probably null Het
Odc1 T A 12: 17,548,841 S241T probably damaging Het
Olfr128 A T 17: 37,923,625 N20Y possibly damaging Het
Olfr744 A T 14: 50,618,774 D184V probably damaging Het
Pcnx3 T C 19: 5,672,587 D951G probably damaging Het
Pigg T C 5: 108,336,542 F685L probably benign Het
Pnpla7 T A 2: 25,053,784 probably benign Het
Pramef25 C T 4: 143,950,728 V94M probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rp1l1 A T 14: 64,031,590 T1542S probably benign Het
Sct A T 7: 141,278,848 L57Q probably damaging Het
Serpinb3b T C 1: 107,154,587 S316G possibly damaging Het
Shprh T C 10: 11,186,869 L1240S probably damaging Het
Slc4a1 C T 11: 102,350,307 E924K probably damaging Het
Sp7 A T 15: 102,359,018 Y118N possibly damaging Het
Srebf2 A G 15: 82,203,735 T219A probably damaging Het
Tenm3 G T 8: 48,310,761 P753T probably damaging Het
Tonsl A T 15: 76,638,853 probably null Het
Trio A T 15: 27,742,380 S2675T possibly damaging Het
Tspan12 T C 6: 21,795,694 T166A probably damaging Het
Ttll4 A G 1: 74,697,482 D1122G probably benign Het
Vmn1r77 G A 7: 12,041,623 A41T probably damaging Het
Xpo7 A T 14: 70,695,624 F276Y probably benign Het
Zdhhc1 A T 8: 105,478,746 probably null Het
Zfp319 C A 8: 95,328,789 C262F probably damaging Het
Zfp442 C T 2: 150,408,662 C383Y probably damaging Het
Zfp57 G T 17: 37,009,758 R168L possibly damaging Het
Other mutations in Gen1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00730:Gen1 APN 12 11261067 missense probably damaging 1.00
IGL01308:Gen1 APN 12 11256870 missense probably damaging 1.00
IGL01384:Gen1 APN 12 11255241 missense probably benign 0.00
IGL01766:Gen1 APN 12 11256894 missense probably damaging 1.00
IGL02132:Gen1 APN 12 11241866 missense probably benign 0.37
IGL02191:Gen1 APN 12 11242296 missense probably benign 0.18
IGL02452:Gen1 APN 12 11242575 missense probably benign 0.02
IGL02479:Gen1 APN 12 11241935 missense probably benign 0.01
IGL02690:Gen1 APN 12 11241575 missense probably damaging 0.96
IGL03095:Gen1 APN 12 11248264 missense probably benign 0.38
PIT4520001:Gen1 UTSW 12 11241508 missense probably benign 0.12
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0014:Gen1 UTSW 12 11241641 missense probably benign 0.44
R0355:Gen1 UTSW 12 11248354 splice site probably benign
R0680:Gen1 UTSW 12 11241869 missense probably benign 0.06
R0891:Gen1 UTSW 12 11248354 splice site probably benign
R1192:Gen1 UTSW 12 11255218 missense probably damaging 0.97
R1353:Gen1 UTSW 12 11243219 missense probably benign 0.00
R1833:Gen1 UTSW 12 11248351 splice site probably benign
R2138:Gen1 UTSW 12 11241621 missense probably damaging 1.00
R2185:Gen1 UTSW 12 11261040 missense probably null 0.95
R2409:Gen1 UTSW 12 11249164 missense possibly damaging 0.75
R2876:Gen1 UTSW 12 11242068 missense probably benign 0.13
R3815:Gen1 UTSW 12 11252033 missense possibly damaging 0.84
R4402:Gen1 UTSW 12 11242362 missense possibly damaging 0.71
R4572:Gen1 UTSW 12 11242418 missense probably damaging 0.99
R4900:Gen1 UTSW 12 11241560 missense probably benign 0.00
R5091:Gen1 UTSW 12 11246346 missense probably damaging 0.97
R5952:Gen1 UTSW 12 11260896 missense probably damaging 0.96
R6785:Gen1 UTSW 12 11262530 missense possibly damaging 0.89
R6869:Gen1 UTSW 12 11241441 missense probably benign 0.02
R7057:Gen1 UTSW 12 11242418 missense probably benign 0.21
R7155:Gen1 UTSW 12 11241832 missense probably benign 0.25
R7260:Gen1 UTSW 12 11256848 missense probably damaging 0.99
R7316:Gen1 UTSW 12 11241469 missense probably benign
R7512:Gen1 UTSW 12 11260976 missense not run
Predicted Primers PCR Primer
(F):5'- AGGACTTCTCCCTAGATCTGAGAAC -3'
(R):5'- CGACTCCAAGAAAACTGCGG -3'

Sequencing Primer
(F):5'- CCTAGATCTGAGAACCCGTTTTC -3'
(R):5'- TGCGGGGCGAATACTTCCTTAC -3'
Posted On2014-06-30