Incidental Mutation 'R1898:Odc1'
ID212148
Institutional Source Beutler Lab
Gene Symbol Odc1
Ensembl Gene ENSMUSG00000011179
Gene Nameornithine decarboxylase, structural 1
SynonymsODC
MMRRC Submission 039918-MU
Accession Numbers

Genbank: NM_013614.2

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1898 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location17544794-17551505 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17548841 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 241 (S241T)
Ref Sequence ENSEMBL: ENSMUSP00000128661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171737] [ENSMUST00000222617]
PDB Structure
CRYSTAL STRUCTURE ORNITHINE DECARBOXYLASE FROM MOUSE, TRUNCATED 37 RESIDUES FROM THE C-TERMINUS, TO 1.6 ANGSTROM RESOLUTION [X-RAY DIFFRACTION]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082493
Predicted Effect probably damaging
Transcript: ENSMUST00000171737
AA Change: S241T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128661
Gene: ENSMUSG00000011179
AA Change: S241T

DomainStartEndE-ValueType
Pfam:Orn_Arg_deC_N 44 282 2.2e-93 PFAM
Pfam:Orn_DAP_Arg_deC 286 407 1.7e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220947
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221354
Predicted Effect probably benign
Transcript: ENSMUST00000221613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221701
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222250
Predicted Effect probably benign
Transcript: ENSMUST00000222617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222758
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.8%
  • 10x: 95.3%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the rate-limiting enzyme of the polyamine biosynthesis pathway which catalyzes ornithine to putrescine. The activity level for the enzyme varies in response to growth-promoting stimuli and exhibits a high turnover rate in comparison to other mammalian proteins. Originally localized to both chromosomes 2 and 7, the gene encoding this enzyme has been determined to be located on 2p25, with a pseudogene located on 7q31-qter. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous null embryos die prior to gastrulation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(3) Gene trapped(6)  

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,735,132 N789S possibly damaging Het
Abca1 C A 4: 53,071,977 R1195L probably benign Het
Abca14 A G 7: 120,251,169 Y748C probably damaging Het
Abca6 A G 11: 110,208,799 F974S probably damaging Het
Acyp1 T C 12: 85,288,340 K2E probably benign Het
Ahcy T A 2: 155,062,253 S355C probably benign Het
AI182371 A G 2: 35,100,649 V12A probably damaging Het
Ankrd36 T C 11: 5,575,683 I215T probably benign Het
Aox1 C T 1: 58,078,442 R828C probably damaging Het
Atp1a4 T A 1: 172,235,048 I631F probably damaging Het
Brinp3 T G 1: 146,901,249 V478G possibly damaging Het
Cadm2 G A 16: 66,815,383 S106L probably damaging Het
Celf2 C T 2: 6,604,164 V95M probably damaging Het
Chka A T 19: 3,892,205 E404D probably damaging Het
Clec5a A C 6: 40,581,936 V72G probably benign Het
Cnn1 T C 9: 22,101,264 probably null Het
Coq6 A G 12: 84,366,963 E89G probably benign Het
Cpne6 A T 14: 55,517,028 I538F possibly damaging Het
Crx G A 7: 15,868,223 P177S probably damaging Het
Cysltr2 G T 14: 73,029,533 P246T probably damaging Het
Decr1 A G 4: 15,929,801 I164T probably damaging Het
Dmtf1 A T 5: 9,128,091 V315E probably damaging Het
Dnah7b A G 1: 46,236,714 N2587S probably benign Het
E2f6 C A 12: 16,824,580 T221K probably benign Het
Fat3 T G 9: 15,960,130 D3655A probably damaging Het
Fbxw28 G A 9: 109,323,384 T384I probably benign Het
Fes T A 7: 80,379,911 I608F probably damaging Het
Flnc G A 6: 29,438,666 W186* probably null Het
Gabrb2 A G 11: 42,593,832 K239E possibly damaging Het
Gen1 T C 12: 11,241,608 R727G probably benign Het
Glb1 T A 9: 114,424,035 V184E probably damaging Het
Gngt1 A T 6: 3,996,724 I57F possibly damaging Het
Ice1 T C 13: 70,602,307 I87V possibly damaging Het
Itih1 A G 14: 30,932,287 Y674H probably benign Het
Itsn1 T A 16: 91,899,580 C24S probably damaging Het
Loxl1 A G 9: 58,297,678 V418A probably damaging Het
Myh10 A G 11: 68,771,906 N595S probably damaging Het
Myo5c C T 9: 75,297,626 T1587I probably damaging Het
Npat T A 9: 53,563,637 F910I probably damaging Het
Nradd T C 9: 110,621,608 Y167C probably damaging Het
Nt5dc1 T C 10: 34,313,635 E352G probably benign Het
Numa1 T C 7: 101,992,720 probably null Het
Olfr128 A T 17: 37,923,625 N20Y possibly damaging Het
Olfr744 A T 14: 50,618,774 D184V probably damaging Het
Pcnx3 T C 19: 5,672,587 D951G probably damaging Het
Pigg T C 5: 108,336,542 F685L probably benign Het
Pnpla7 T A 2: 25,053,784 probably benign Het
Pramef25 C T 4: 143,950,728 V94M probably damaging Het
Rcsd1 C T 1: 165,659,429 A72T probably benign Het
Rp1l1 A T 14: 64,031,590 T1542S probably benign Het
Sct A T 7: 141,278,848 L57Q probably damaging Het
Serpinb3b T C 1: 107,154,587 S316G possibly damaging Het
Shprh T C 10: 11,186,869 L1240S probably damaging Het
Slc4a1 C T 11: 102,350,307 E924K probably damaging Het
Sp7 A T 15: 102,359,018 Y118N possibly damaging Het
Srebf2 A G 15: 82,203,735 T219A probably damaging Het
Tenm3 G T 8: 48,310,761 P753T probably damaging Het
Tonsl A T 15: 76,638,853 probably null Het
Trio A T 15: 27,742,380 S2675T possibly damaging Het
Tspan12 T C 6: 21,795,694 T166A probably damaging Het
Ttll4 A G 1: 74,697,482 D1122G probably benign Het
Vmn1r77 G A 7: 12,041,623 A41T probably damaging Het
Xpo7 A T 14: 70,695,624 F276Y probably benign Het
Zdhhc1 A T 8: 105,478,746 probably null Het
Zfp319 C A 8: 95,328,789 C262F probably damaging Het
Zfp442 C T 2: 150,408,662 C383Y probably damaging Het
Zfp57 G T 17: 37,009,758 R168L possibly damaging Het
Other mutations in Odc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Odc1 APN 12 17547673 missense probably damaging 1.00
IGL02234:Odc1 APN 12 17548620 missense possibly damaging 0.95
IGL03007:Odc1 APN 12 17548810 missense probably benign 0.01
F5426:Odc1 UTSW 12 17549423 critical splice acceptor site probably null
H8562:Odc1 UTSW 12 17548037 missense probably benign 0.11
R1648:Odc1 UTSW 12 17548537 splice site probably benign
R2224:Odc1 UTSW 12 17547335 missense probably benign 0.05
R2274:Odc1 UTSW 12 17548424 missense probably benign 0.01
R3932:Odc1 UTSW 12 17548800 missense probably benign 0.38
R4883:Odc1 UTSW 12 17547385 missense possibly damaging 0.82
R4956:Odc1 UTSW 12 17547957 missense probably damaging 1.00
R5036:Odc1 UTSW 12 17548019 missense probably damaging 1.00
R6112:Odc1 UTSW 12 17549472 missense probably benign 0.23
R6261:Odc1 UTSW 12 17550654 missense probably benign 0.00
R7092:Odc1 UTSW 12 17548313 missense possibly damaging 0.90
R7101:Odc1 UTSW 12 17547318 missense probably benign
R7243:Odc1 UTSW 12 17550057 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTGACATGGCAGTGAGTACAC -3'
(R):5'- GCTACCGTACACCAGTCAATG -3'

Sequencing Primer
(F):5'- TACACGGGACTTGTTCAAGG -3'
(R):5'- CCAGTCAATGGGATTGCAGC -3'
Posted On2014-06-30