Incidental Mutation 'R0124:Vmn2r27'
ID21217
Institutional Source Beutler Lab
Gene Symbol Vmn2r27
Ensembl Gene ENSMUSG00000072778
Gene Namevomeronasal 2, receptor27
SynonymsEG232367
MMRRC Submission 038409-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0124 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location124191596-124231784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124231619 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 56 (T56S)
Ref Sequence ENSEMBL: ENSMUSP00000098528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100968]
Predicted Effect probably benign
Transcript: ENSMUST00000100968
AA Change: T56S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098528
Gene: ENSMUSG00000072778
AA Change: T56S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 81 475 1.1e-27 PFAM
Pfam:NCD3G 519 570 1.3e-18 PFAM
Pfam:7tm_3 603 838 2.6e-50 PFAM
Meta Mutation Damage Score 0.1328 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in Vmn2r27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Vmn2r27 APN 6 124192411 missense possibly damaging 0.86
IGL01388:Vmn2r27 APN 6 124223832 missense possibly damaging 0.55
IGL01923:Vmn2r27 APN 6 124200525 missense probably benign 0.20
IGL01954:Vmn2r27 APN 6 124192248 missense probably damaging 1.00
IGL02105:Vmn2r27 APN 6 124197349 splice site probably benign
IGL02586:Vmn2r27 APN 6 124224475 nonsense probably null
IGL03130:Vmn2r27 APN 6 124192317 missense possibly damaging 0.82
IGL03330:Vmn2r27 APN 6 124230180 nonsense probably null
R0234:Vmn2r27 UTSW 6 124231619 missense probably benign
R0234:Vmn2r27 UTSW 6 124231619 missense probably benign
R0384:Vmn2r27 UTSW 6 124223912 missense probably benign 0.01
R0582:Vmn2r27 UTSW 6 124224290 missense probably benign 0.02
R0733:Vmn2r27 UTSW 6 124192188 missense probably benign 0.18
R0738:Vmn2r27 UTSW 6 124223702 missense possibly damaging 0.48
R0835:Vmn2r27 UTSW 6 124200624 missense probably damaging 0.99
R1183:Vmn2r27 UTSW 6 124200532 missense probably benign
R1401:Vmn2r27 UTSW 6 124191632 nonsense probably null
R1484:Vmn2r27 UTSW 6 124200515 missense probably damaging 0.96
R1536:Vmn2r27 UTSW 6 124200690 missense probably damaging 1.00
R1539:Vmn2r27 UTSW 6 124191771 missense probably damaging 1.00
R1565:Vmn2r27 UTSW 6 124231634 missense probably benign
R1595:Vmn2r27 UTSW 6 124231615 missense probably benign 0.00
R1614:Vmn2r27 UTSW 6 124223934 missense probably benign 0.01
R1742:Vmn2r27 UTSW 6 124200677 missense possibly damaging 0.48
R1816:Vmn2r27 UTSW 6 124230371 nonsense probably null
R1822:Vmn2r27 UTSW 6 124231634 missense probably benign
R1824:Vmn2r27 UTSW 6 124231634 missense probably benign
R1870:Vmn2r27 UTSW 6 124224211 missense probably benign 0.11
R1942:Vmn2r27 UTSW 6 124223763 missense probably damaging 1.00
R1962:Vmn2r27 UTSW 6 124223834 missense possibly damaging 0.70
R2069:Vmn2r27 UTSW 6 124224483 missense probably damaging 1.00
R2075:Vmn2r27 UTSW 6 124200551 missense possibly damaging 0.85
R2379:Vmn2r27 UTSW 6 124224383 missense possibly damaging 0.89
R3748:Vmn2r27 UTSW 6 124230392 missense probably benign 0.35
R4384:Vmn2r27 UTSW 6 124224156 missense probably benign 0.05
R4392:Vmn2r27 UTSW 6 124230176 missense probably benign 0.01
R4758:Vmn2r27 UTSW 6 124231637 missense possibly damaging 0.87
R5018:Vmn2r27 UTSW 6 124224182 missense probably benign 0.02
R5235:Vmn2r27 UTSW 6 124192054 missense probably damaging 0.99
R5718:Vmn2r27 UTSW 6 124192144 missense possibly damaging 0.66
R5859:Vmn2r27 UTSW 6 124200688 missense probably damaging 1.00
R5958:Vmn2r27 UTSW 6 124231727 missense probably benign 0.00
R6044:Vmn2r27 UTSW 6 124231772 missense probably benign
R6086:Vmn2r27 UTSW 6 124191999 missense probably damaging 1.00
R6396:Vmn2r27 UTSW 6 124224166 nonsense probably null
R6546:Vmn2r27 UTSW 6 124192410 missense possibly damaging 0.49
R6746:Vmn2r27 UTSW 6 124200593 missense possibly damaging 0.47
R6976:Vmn2r27 UTSW 6 124224353 nonsense probably null
R7091:Vmn2r27 UTSW 6 124223945 missense possibly damaging 0.85
R7145:Vmn2r27 UTSW 6 124191752 missense probably benign
R7176:Vmn2r27 UTSW 6 124192036 missense probably benign 0.01
R7382:Vmn2r27 UTSW 6 124197317 missense probably damaging 1.00
R7482:Vmn2r27 UTSW 6 124224261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCCATAAAGTTGAAGGCAGGATAC -3'
(R):5'- GCAACTCTGTGAAGGGGACACAATC -3'

Sequencing Primer
(F):5'- GTTGAAGGCAGGATACATTGG -3'
(R):5'- CAAATTATACTCCCTGGAACTGAGG -3'
Posted On2013-04-11