Incidental Mutation 'R0124:Col4a2'
ID21223
Institutional Source Beutler Lab
Gene Symbol Col4a2
Ensembl Gene ENSMUSG00000031503
Gene Namecollagen, type IV, alpha 2
SynonymsCol4a-2
MMRRC Submission 038409-MU
Accession Numbers

Genbank: NM_009932

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0124 (G1)
Quality Score178
Status Validated (trace)
Chromosome8
Chromosomal Location11312805-11449287 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 11408871 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033899]
Predicted Effect probably benign
Transcript: ENSMUST00000033899
SMART Domains Protein: ENSMUSP00000033899
Gene: ENSMUSG00000031503

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 56 119 1.2e-10 PFAM
Pfam:Collagen 112 174 3.9e-8 PFAM
low complexity region 193 229 N/A INTRINSIC
Pfam:Collagen 289 348 1.3e-10 PFAM
low complexity region 370 389 N/A INTRINSIC
low complexity region 427 445 N/A INTRINSIC
Pfam:Collagen 488 546 2e-10 PFAM
Pfam:Collagen 590 655 4.5e-9 PFAM
low complexity region 665 673 N/A INTRINSIC
Pfam:Collagen 674 731 3.5e-10 PFAM
Pfam:Collagen 714 775 4.3e-10 PFAM
Pfam:Collagen 773 831 1.5e-10 PFAM
Pfam:Collagen 861 935 8.1e-10 PFAM
Pfam:Collagen 915 976 1.1e-9 PFAM
Pfam:Collagen 978 1038 2.6e-8 PFAM
Pfam:Collagen 1027 1091 1.7e-10 PFAM
Pfam:Collagen 1094 1155 5.5e-11 PFAM
Pfam:Collagen 1147 1211 1e-10 PFAM
Pfam:Collagen 1271 1340 2.1e-8 PFAM
Pfam:Collagen 1330 1392 7.1e-10 PFAM
C4 1484 1591 7.85e-59 SMART
C4 1592 1706 7.65e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145295
SMART Domains Protein: ENSMUSP00000114737
Gene: ENSMUSG00000031503

DomainStartEndE-ValueType
Pfam:Collagen 6 55 9.7e-8 PFAM
Pfam:Collagen 81 140 4.4e-12 PFAM
Pfam:Collagen 145 210 2.7e-8 PFAM
Pfam:Collagen 184 239 2.9e-8 PFAM
low complexity region 280 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148654
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of alpha-1 and alpha-2 subunits that assembles into a type IV collagen network. Canstatin, a peptide derived fom the C-terminus of the collagen chain, is a matrikine that has been shown to inhibit angiogenesis. Homozygous knockout mice for this gene exhibit impaired basement membrane integrity and embryonic lethality. This gene shares a bi-directional promoter with a related gene on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: ENU-induced missense mutations of this gene result in a variable phenotype affecting the eye, brain and vascular stability in heterozygotes, and fetal or postnatal survival in homozygotes. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(6) Chemically induced(3)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tfap2a G A 13: 40,717,411 probably benign Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in Col4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col4a2 APN 8 11443685 missense probably damaging 1.00
IGL00485:Col4a2 APN 8 11439012 missense probably benign
IGL00909:Col4a2 APN 8 11448167 missense possibly damaging 0.91
IGL01574:Col4a2 APN 8 11439306 missense probably damaging 1.00
IGL01914:Col4a2 APN 8 11414754 missense possibly damaging 0.57
IGL02147:Col4a2 APN 8 11408140 missense probably benign 0.28
IGL02205:Col4a2 APN 8 11431305 nonsense probably null
IGL02423:Col4a2 APN 8 11433800 missense probably benign
IGL03131:Col4a2 APN 8 11425979 missense probably benign
band UTSW 8 11448225 missense probably benign 0.00
binder UTSW 8 11416070 missense probably damaging 1.00
G4846:Col4a2 UTSW 8 11408872 splice site probably benign
IGL03054:Col4a2 UTSW 8 11448270 missense probably damaging 0.96
R0087:Col4a2 UTSW 8 11441296 missense probably benign
R0603:Col4a2 UTSW 8 11414779 missense probably benign
R0646:Col4a2 UTSW 8 11431252 missense probably benign 0.17
R0970:Col4a2 UTSW 8 11415438 missense probably benign 0.00
R1738:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R1746:Col4a2 UTSW 8 11446020 missense probably benign 0.35
R1826:Col4a2 UTSW 8 11313509 critical splice donor site probably null
R1834:Col4a2 UTSW 8 11402997 missense probably benign 0.10
R2016:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2017:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2124:Col4a2 UTSW 8 11416070 missense probably damaging 1.00
R2137:Col4a2 UTSW 8 11433749 missense probably benign
R2207:Col4a2 UTSW 8 11443352 missense probably damaging 1.00
R3156:Col4a2 UTSW 8 11313414 unclassified probably benign
R4169:Col4a2 UTSW 8 11429391 missense probably benign 0.22
R4679:Col4a2 UTSW 8 11431337 missense possibly damaging 0.68
R4705:Col4a2 UTSW 8 11313504 missense possibly damaging 0.52
R4710:Col4a2 UTSW 8 11409462 missense probably benign 0.22
R4716:Col4a2 UTSW 8 11402224 missense probably damaging 1.00
R4730:Col4a2 UTSW 8 11437590 missense probably benign
R4732:Col4a2 UTSW 8 11414779 missense probably benign
R4732:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4733:Col4a2 UTSW 8 11414779 missense probably benign
R4733:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4834:Col4a2 UTSW 8 11406836 nonsense probably null
R4835:Col4a2 UTSW 8 11423570 nonsense probably null
R4953:Col4a2 UTSW 8 11429505 missense probably benign 0.02
R5078:Col4a2 UTSW 8 11443936 missense probably benign
R5204:Col4a2 UTSW 8 11398651 splice site probably null
R5221:Col4a2 UTSW 8 11448225 missense probably benign 0.00
R5355:Col4a2 UTSW 8 11445984 missense probably damaging 0.96
R5478:Col4a2 UTSW 8 11398697 missense probably benign 0.21
R5492:Col4a2 UTSW 8 11438608 missense possibly damaging 0.82
R5646:Col4a2 UTSW 8 11441281 missense probably damaging 1.00
R5857:Col4a2 UTSW 8 11425442 missense probably damaging 1.00
R5948:Col4a2 UTSW 8 11420600 missense probably benign 0.21
R6329:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R6496:Col4a2 UTSW 8 11402993 nonsense probably null
R6496:Col4a2 UTSW 8 11402994 missense probably damaging 1.00
R6531:Col4a2 UTSW 8 11408135 missense probably benign 0.00
R7185:Col4a2 UTSW 8 11399739 missense probably damaging 0.99
R7196:Col4a2 UTSW 8 11398693 missense probably damaging 1.00
R7266:Col4a2 UTSW 8 11425542 critical splice donor site probably null
R7308:Col4a2 UTSW 8 11406856 critical splice donor site probably null
R7341:Col4a2 UTSW 8 11398678 missense probably damaging 0.97
R7394:Col4a2 UTSW 8 11446184 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCAACTGCCTTTTCCTACGAAGAC -3'
(R):5'- ACGGTGTAACCATGATGCCTCCTC -3'

Sequencing Primer
(F):5'- GAAAGACAGTCCCTGTTTGC -3'
(R):5'- GATGCCTCCTCACATAGAGAAGTG -3'
Posted On2013-04-11