Incidental Mutation 'R1902:Lrp1b'
ID212287
Institutional Source Beutler Lab
Gene Symbol Lrp1b
Ensembl Gene ENSMUSG00000049252
Gene Namelow density lipoprotein-related protein 1B (deleted in tumors)
Synonyms9630004P12Rik
MMRRC Submission 039922-MU
Accession Numbers

Genbank: NM_053011.2

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1902 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location40595246-42653624 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40860661 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 2964 (S2964G)
Ref Sequence ENSEMBL: ENSMUSP00000129192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052550] [ENSMUST00000167270]
Predicted Effect probably benign
Transcript: ENSMUST00000052550
AA Change: S3078G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000054275
Gene: ENSMUSG00000049252
AA Change: S3078G

DomainStartEndE-ValueType
low complexity region 3 19 N/A INTRINSIC
low complexity region 35 46 N/A INTRINSIC
LDLa 62 102 2.97e-12 SMART
LDLa 107 146 1.31e-8 SMART
EGF 150 185 1.95e1 SMART
EGF_CA 186 225 8.37e-8 SMART
LY 256 300 4.06e1 SMART
LY 304 348 1.15e-5 SMART
LY 349 392 1.17e-11 SMART
LY 393 435 1.12e-8 SMART
LY 436 478 2.21e1 SMART
EGF 505 548 2.45e0 SMART
LY 579 621 1.32e-5 SMART
LY 622 665 1.88e-10 SMART
LY 668 717 1.47e-12 SMART
LY 718 760 5.78e-11 SMART
LY 761 802 1.45e0 SMART
EGF_like 828 865 4.55e1 SMART
LDLa 875 914 7.15e-15 SMART
LDLa 916 955 5.26e-13 SMART
LDLa 957 995 6.13e-14 SMART
LDLa 997 1035 6.47e-13 SMART
LDLa 1036 1075 1.76e-14 SMART
LDLa 1083 1121 2.29e-13 SMART
LDLa 1125 1164 3.36e-11 SMART
LDLa 1166 1206 2.57e-7 SMART
EGF 1206 1244 1.58e-3 SMART
EGF 1248 1284 4.56e0 SMART
LY 1311 1353 4.85e-4 SMART
LY 1358 1400 6.49e-14 SMART
LY 1401 1445 8.18e-11 SMART
LY 1446 1490 4.25e-9 SMART
LY 1492 1534 5.4e-2 SMART
EGF 1561 1601 9.41e-2 SMART
LY 1629 1671 3.03e-5 SMART
LY 1672 1716 1.22e-9 SMART
LY 1718 1756 1.02e-2 SMART
LY 1757 1798 8.25e-7 SMART
EGF 1868 1906 4.03e-1 SMART
LY 1933 1975 1.01e-1 SMART
LY 1976 2018 3.03e-14 SMART
LY 2019 2062 2.16e-10 SMART
LY 2063 2105 4.09e-11 SMART
LY 2107 2149 9.96e0 SMART
EGF 2177 2214 2.13e0 SMART
LY 2292 2334 6.96e-5 SMART
LY 2340 2385 1.07e-5 SMART
LY 2386 2428 1.1e-11 SMART
LY 2429 2470 4.78e-3 SMART
EGF 2498 2535 2.03e1 SMART
LDLa 2540 2580 1.1e-6 SMART
LDLa 2582 2619 1.72e-8 SMART
LDLa 2621 2658 2.45e-13 SMART
LDLa 2669 2707 6.53e-9 SMART
LDLa 2712 2749 7.97e-13 SMART
LDLa 2750 2789 1.22e-8 SMART
LDLa 2791 2832 3.07e-14 SMART
LDLa 2835 2873 7.32e-12 SMART
LDLa 2875 2917 1.85e-8 SMART
LDLa 2921 2958 4.76e-11 SMART
EGF_CA 2957 2998 1.79e-7 SMART
EGF_CA 2999 3039 1.85e-9 SMART
LY 3066 3111 2.58e-8 SMART
LY 3112 3152 1.22e-9 SMART
LY 3153 3196 8.84e-7 SMART
LY 3197 3237 3.22e-9 SMART
LY 3238 3279 1.04e-3 SMART
EGF 3307 3345 7.13e-2 SMART
LDLa 3347 3385 9.29e-14 SMART
LDLa 3387 3424 2.25e-12 SMART
LDLa 3426 3464 5.63e-13 SMART
LDLa 3466 3504 1.07e-13 SMART
LDLa 3506 3543 1.35e-15 SMART
EGF_like 3545 3581 2.8e1 SMART
LDLa 3545 3582 1.49e-12 SMART
LDLa 3583 3620 4.21e-12 SMART
LDLa 3624 3661 4.9e-13 SMART
LDLa 3662 3700 9.58e-16 SMART
LDLa 3704 3743 5.38e-10 SMART
LDLa 3745 3784 1.42e-9 SMART
LDLa 3792 3829 3.66e-12 SMART
EGF 3835 3874 3.71e0 SMART
EGF_CA 3875 3912 6.8e-8 SMART
LY 3987 4033 4.24e0 SMART
LY 4050 4093 4.46e-3 SMART
LY 4094 4136 1.73e-9 SMART
EGF 4206 4239 2.45e0 SMART
EGF 4247 4280 2.48e-1 SMART
EGF 4283 4316 1.49e-4 SMART
EGF 4319 4352 1.69e-3 SMART
EGF 4355 4388 1.18e1 SMART
EGF_like 4391 4423 6.67e1 SMART
EGF 4424 4458 1.61e0 SMART
transmembrane domain 4476 4498 N/A INTRINSIC
low complexity region 4499 4509 N/A INTRINSIC
low complexity region 4512 4523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167270
AA Change: S2964G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129192
Gene: ENSMUSG00000049252
AA Change: S2964G

DomainStartEndE-ValueType
EGF 5 40 1.95e1 SMART
EGF_CA 41 80 8.37e-8 SMART
LY 111 155 4.06e1 SMART
LY 159 203 1.15e-5 SMART
LY 204 247 1.17e-11 SMART
LY 248 290 1.12e-8 SMART
LY 291 333 2.21e1 SMART
EGF 360 403 2.45e0 SMART
LY 434 476 1.32e-5 SMART
LY 477 520 1.88e-10 SMART
LY 523 572 1.47e-12 SMART
LY 573 615 5.78e-11 SMART
LY 616 657 1.45e0 SMART
EGF_like 683 720 4.55e1 SMART
LDLa 730 769 7.15e-15 SMART
LDLa 771 810 5.26e-13 SMART
LDLa 812 850 6.13e-14 SMART
LDLa 852 890 6.47e-13 SMART
LDLa 891 930 1.76e-14 SMART
LDLa 938 976 2.29e-13 SMART
LDLa 980 1019 3.36e-11 SMART
LDLa 1021 1061 2.57e-7 SMART
EGF 1061 1099 1.58e-3 SMART
EGF 1103 1139 4.56e0 SMART
LY 1166 1208 4.85e-4 SMART
LY 1213 1255 6.49e-14 SMART
LY 1256 1300 8.18e-11 SMART
LY 1301 1345 4.25e-9 SMART
LY 1347 1389 5.4e-2 SMART
EGF 1416 1456 9.41e-2 SMART
LY 1484 1526 3.03e-5 SMART
LY 1527 1571 1.22e-9 SMART
LY 1573 1611 1.02e-2 SMART
LY 1612 1653 8.25e-7 SMART
EGF 1723 1761 4.03e-1 SMART
LY 1788 1830 1.01e-1 SMART
LY 1831 1873 3.03e-14 SMART
LY 1874 1917 2.16e-10 SMART
LY 1918 1960 4.09e-11 SMART
LY 1962 2004 9.96e0 SMART
EGF 2032 2069 2.13e0 SMART
LY 2147 2189 6.96e-5 SMART
LY 2195 2240 1.07e-5 SMART
LY 2241 2283 1.1e-11 SMART
LY 2284 2325 4.78e-3 SMART
EGF 2353 2390 2.03e1 SMART
LDLa 2395 2435 1.1e-6 SMART
LDLa 2437 2474 1.72e-8 SMART
LDLa 2476 2513 2.45e-13 SMART
LDLa 2524 2562 6.53e-9 SMART
LDLa 2567 2604 7.97e-13 SMART
LDLa 2605 2644 1.22e-8 SMART
LDLa 2646 2687 3.07e-14 SMART
LDLa 2690 2728 7.32e-12 SMART
LDLa 2730 2772 1.85e-8 SMART
LDLa 2776 2813 4.76e-11 SMART
EGF_CA 2812 2853 1.79e-7 SMART
EGF_CA 2854 2894 1.85e-9 SMART
LY 2921 2966 2.58e-8 SMART
LY 2967 3007 1.22e-9 SMART
LY 3008 3051 8.84e-7 SMART
LY 3052 3092 3.22e-9 SMART
LY 3093 3134 1.04e-3 SMART
EGF 3162 3200 7.13e-2 SMART
LDLa 3202 3240 9.29e-14 SMART
LDLa 3242 3279 2.25e-12 SMART
LDLa 3281 3319 5.63e-13 SMART
LDLa 3321 3357 5.86e-11 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor family. These receptors play a wide variety of roles in normal cell function and development due to their interactions with multiple ligands. Disruption of this gene has been reported in several types of cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice appear normal, are fertile, have normal brain histology and function, normal plasma cholesterol and fasting triglycerides, and do not develop tumors. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(3) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C T 12: 18,534,003 Q355* probably null Het
Acacb A T 5: 114,165,734 R73* probably null Het
Adra1a T C 14: 66,638,235 S220P probably benign Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap45 C A 10: 80,025,466 Q488K probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Atxn7l3b A G 10: 112,928,673 I17T probably benign Het
BC003331 T A 1: 150,388,609 probably null Het
Bpifb9a A T 2: 154,261,991 N118I probably benign Het
Btbd9 A T 17: 30,530,228 D37E probably damaging Het
C8a T C 4: 104,856,601 probably null Het
Capn13 G A 17: 73,326,361 S535F probably damaging Het
Carns1 G T 19: 4,166,338 P615Q probably damaging Het
Casz1 T C 4: 148,936,195 I479T possibly damaging Het
Ccdc88a G T 11: 29,461,788 M532I probably benign Het
Cdc42bpb T G 12: 111,326,016 S362R probably damaging Het
Ceacam11 A T 7: 17,975,327 H150L probably benign Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Cpeb1 T C 7: 81,372,119 D92G probably benign Het
Cped1 T A 6: 22,120,981 probably null Het
Csf1r A G 18: 61,130,141 T896A probably damaging Het
Csf3r T C 4: 126,042,918 F658S probably damaging Het
Cts6 A T 13: 61,201,515 Y126* probably null Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Cxcl5 T C 5: 90,759,785 V72A probably damaging Het
Cyp4v3 T A 8: 45,306,952 H521L probably benign Het
Dct T C 14: 118,034,278 N380S probably benign Het
Dnah1 T C 14: 31,319,759 D85G probably damaging Het
Dnah7a T C 1: 53,535,478 D1709G probably damaging Het
Dnaic1 A T 4: 41,625,319 K428* probably null Het
Dsc1 A T 18: 20,095,988 V415D probably damaging Het
E2f8 T C 7: 48,871,172 H467R probably benign Het
Eddm3b T A 14: 51,116,864 I103N probably damaging Het
Fam71b A T 11: 46,407,011 T381S probably benign Het
Gal3st2c T G 1: 94,008,889 N185K probably damaging Het
Ganc T C 2: 120,446,482 L675P probably damaging Het
Gdf9 G A 11: 53,436,953 M245I probably benign Het
Gm21886 G A 18: 80,089,418 T175I probably damaging Het
Gria2 A G 3: 80,722,108 L269P probably damaging Het
Grm8 T C 6: 27,429,482 Y471C probably damaging Het
Gucy2g T A 19: 55,210,237 T825S probably benign Het
H2-Bl A T 17: 36,083,953 M16K probably damaging Het
Iffo2 T C 4: 139,607,701 S124P probably damaging Het
Igf1r T C 7: 68,201,249 Y931H possibly damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itgb4 T C 11: 115,980,738 V179A probably damaging Het
Itpr2 T A 6: 146,229,703 H1968L probably damaging Het
Kdm4a A G 4: 118,160,399 V490A probably benign Het
Kif13a A T 13: 46,788,162 D946E probably benign Het
Klhl22 T A 16: 17,771,787 I104N probably damaging Het
Klk6 A C 7: 43,826,057 M1L probably benign Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Larp7 A T 3: 127,540,578 N533K probably damaging Het
Lrit3 T C 3: 129,791,246 T288A probably benign Het
Lrp11 T A 10: 7,623,780 L245Q probably damaging Het
Lrrc66 C T 5: 73,607,622 V693M probably damaging Het
Macf1 T A 4: 123,471,165 M3268L probably benign Het
Mad1l1 A G 5: 140,303,688 S161P possibly damaging Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Morc3 A G 16: 93,870,497 T588A probably damaging Het
Mospd3 A G 5: 137,600,415 S21P probably damaging Het
Mrpl57 T A 14: 57,826,729 F71L probably damaging Het
Mtbp T C 15: 55,606,715 L594S probably damaging Het
Mthfd2 T C 6: 83,306,731 N323S probably damaging Het
Muc5b G T 7: 141,864,105 S3596I possibly damaging Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncoa1 A T 12: 4,339,049 D75E possibly damaging Het
Ncor1 A C 11: 62,338,158 I958S probably damaging Het
Nefm T C 14: 68,124,114 S234G probably benign Het
Nlrp4c T C 7: 6,065,819 S240P probably damaging Het
Nox3 C T 17: 3,670,017 V298M probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Nudt13 C G 14: 20,310,641 T174R probably damaging Het
Olfr1002 T C 2: 85,647,857 S155G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr1245 A T 2: 89,575,603 L41Q possibly damaging Het
Olfr1512 T G 14: 52,372,717 Q112P possibly damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr355 T C 2: 36,927,185 I310V probably benign Het
Olfr430 T C 1: 174,070,126 V276A probably damaging Het
Olfr437 T A 6: 43,167,723 probably null Het
Olfr812 G T 10: 129,842,506 P179T probably benign Het
Olfr967 T C 9: 39,750,806 V140A probably benign Het
Opn1sw T A 6: 29,379,804 N144Y possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Parp14 C T 16: 35,853,518 probably null Het
Pde3a C A 6: 141,498,770 N1101K probably benign Het
Plcb1 G A 2: 134,813,613 V38I possibly damaging Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Ppfibp2 C T 7: 107,746,378 P869L probably damaging Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Pramel5 G A 4: 144,273,863 Q48* probably null Het
Prr13 C A 15: 102,460,698 probably benign Het
Psg22 T A 7: 18,724,438 Y312* probably null Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
Rasa4 A G 5: 136,091,238 D56G probably benign Het
Rif1 T A 2: 52,116,673 N2206K possibly damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Samd4 T C 14: 47,074,128 F81S probably damaging Het
Sh3pxd2b T C 11: 32,423,559 *909Q probably null Het
Slc25a45 A G 19: 5,884,522 R173G probably damaging Het
Smarca1 G A X: 47,849,963 Q723* probably null Het
Smoc1 T C 12: 81,104,671 I54T probably benign Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Steap3 T G 1: 120,241,734 I240L probably benign Het
Stmn4 C T 14: 66,355,609 L13F probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Syt3 T C 7: 44,390,516 S58P possibly damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tbc1d19 T A 5: 53,829,353 C35S probably benign Het
Tcaf3 T C 6: 42,593,552 E422G possibly damaging Het
Tekt4 T A 17: 25,471,858 F46Y possibly damaging Het
Tnfaip3 T C 10: 19,008,189 K148E probably benign Het
Trrap T G 5: 144,816,053 I1813R probably damaging Het
Ttc29 A G 8: 78,251,732 E137G probably benign Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Tyro3 T C 2: 119,801,695 I81T possibly damaging Het
Upp2 T G 2: 58,771,452 M71R probably damaging Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vcl T A 14: 20,982,699 L122Q probably damaging Het
Vmn1r213 A C 13: 23,012,306 N353T possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp869 T C 8: 69,707,438 K162E probably benign Het
Other mutations in Lrp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lrp1b APN 2 41110861 missense probably damaging 1.00
IGL00543:Lrp1b APN 2 41468948 missense possibly damaging 0.69
IGL00578:Lrp1b APN 2 40679173 missense unknown
IGL01020:Lrp1b APN 2 40998247 missense probably damaging 1.00
IGL01092:Lrp1b APN 2 40750947 missense probably damaging 0.97
IGL01155:Lrp1b APN 2 41770935 missense probably benign 0.17
IGL01361:Lrp1b APN 2 41110751 splice site probably benign
IGL01377:Lrp1b APN 2 40601538 missense probably damaging 1.00
IGL01459:Lrp1b APN 2 40860714 missense probably damaging 0.97
IGL01473:Lrp1b APN 2 40611486 missense probably damaging 0.97
IGL01528:Lrp1b APN 2 40919182 missense probably damaging 0.99
IGL01536:Lrp1b APN 2 41110883 missense probably benign 0.01
IGL01564:Lrp1b APN 2 40677486 splice site probably benign
IGL01747:Lrp1b APN 2 40860685 missense probably damaging 1.00
IGL01764:Lrp1b APN 2 40697442 missense unknown
IGL01783:Lrp1b APN 2 41312572 missense probably damaging 1.00
IGL01802:Lrp1b APN 2 41511482 missense probably benign 0.07
IGL01826:Lrp1b APN 2 41449234 missense probably damaging 1.00
IGL01884:Lrp1b APN 2 41284213 nonsense probably null
IGL01908:Lrp1b APN 2 40702804 missense probably benign
IGL01935:Lrp1b APN 2 41268355 missense probably damaging 1.00
IGL01959:Lrp1b APN 2 41312527 missense probably damaging 0.99
IGL02010:Lrp1b APN 2 41468942 missense probably damaging 1.00
IGL02022:Lrp1b APN 2 41282160 missense probably damaging 1.00
IGL02028:Lrp1b APN 2 41511452 missense probably damaging 1.00
IGL02034:Lrp1b APN 2 41268370 nonsense probably null
IGL02043:Lrp1b APN 2 40697525 missense probably null 0.44
IGL02066:Lrp1b APN 2 41111079 nonsense probably null
IGL02085:Lrp1b APN 2 40889309 missense probably benign
IGL02137:Lrp1b APN 2 40730688 splice site probably benign
IGL02218:Lrp1b APN 2 41295672 missense probably benign 0.11
IGL02409:Lrp1b APN 2 41445196 missense possibly damaging 0.93
IGL02513:Lrp1b APN 2 41110753 critical splice donor site probably null
IGL02543:Lrp1b APN 2 40870401 missense possibly damaging 0.89
IGL02701:Lrp1b APN 2 41246017 missense possibly damaging 0.50
IGL02728:Lrp1b APN 2 40801398 missense probably benign 0.03
IGL02739:Lrp1b APN 2 41498215 missense probably damaging 1.00
IGL02748:Lrp1b APN 2 40702749 missense probably damaging 0.99
IGL02754:Lrp1b APN 2 40702794 missense probably benign 0.02
IGL02797:Lrp1b APN 2 41671057 missense probably benign 0.01
IGL02813:Lrp1b APN 2 40679217 critical splice acceptor site probably null
IGL02831:Lrp1b APN 2 41193591 missense probably damaging 1.00
IGL02869:Lrp1b APN 2 40701830 missense unknown
IGL02946:Lrp1b APN 2 41312559 missense probably damaging 1.00
IGL02952:Lrp1b APN 2 41506703 missense probably benign 0.33
IGL02958:Lrp1b APN 2 41302916 missense probably damaging 1.00
IGL02977:Lrp1b APN 2 40730735 missense probably damaging 1.00
IGL03001:Lrp1b APN 2 40927889 missense probably damaging 1.00
IGL03010:Lrp1b APN 2 42323606 missense possibly damaging 0.94
IGL03060:Lrp1b APN 2 40637753 missense probably benign 0.04
IGL03129:Lrp1b APN 2 41312466 splice site probably benign
IGL03166:Lrp1b APN 2 41111038 missense probably damaging 1.00
IGL03170:Lrp1b APN 2 40697444 missense unknown
IGL03195:Lrp1b APN 2 41471122 missense possibly damaging 0.95
IGL03224:Lrp1b APN 2 41471031 missense possibly damaging 0.92
IGL03251:Lrp1b APN 2 40600267 missense probably benign 0.20
IGL03281:Lrp1b APN 2 40725514 missense probably benign 0.01
IGL03295:Lrp1b APN 2 40678987 splice site probably null
IGL03340:Lrp1b APN 2 41468969 missense probably damaging 0.97
IGL03391:Lrp1b APN 2 41295641 missense possibly damaging 0.95
IGL03401:Lrp1b APN 2 41110778 missense probably benign 0.18
IGL03403:Lrp1b APN 2 40702824 missense probably benign 0.16
IGL03408:Lrp1b APN 2 40858582 missense probably damaging 0.97
fetching UTSW 2 40879555 missense probably benign 0.00
Heiden UTSW 2 40637775 missense probably benign 0.00
hither UTSW 2 40702848 missense probably benign 0.00
Roeslein UTSW 2 40725907 missense probably damaging 1.00
I2288:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
I2289:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
LCD18:Lrp1b UTSW 2 42237562 intron probably benign
R0022:Lrp1b UTSW 2 40998038 splice site probably benign
R0022:Lrp1b UTSW 2 40998038 splice site probably benign
R0054:Lrp1b UTSW 2 40742817 missense probably benign 0.11
R0054:Lrp1b UTSW 2 40742817 missense probably benign 0.11
R0094:Lrp1b UTSW 2 41282030 unclassified probably benign
R0102:Lrp1b UTSW 2 41408985 splice site probably benign
R0123:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0128:Lrp1b UTSW 2 41511508 missense probably damaging 1.00
R0130:Lrp1b UTSW 2 41511508 missense probably damaging 1.00
R0134:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0135:Lrp1b UTSW 2 41269239 missense probably damaging 0.99
R0153:Lrp1b UTSW 2 41123019 missense possibly damaging 0.92
R0178:Lrp1b UTSW 2 40725907 missense probably damaging 1.00
R0225:Lrp1b UTSW 2 40596983 missense probably damaging 1.00
R0242:Lrp1b UTSW 2 40998183 missense probably benign 0.01
R0242:Lrp1b UTSW 2 40998183 missense probably benign 0.01
R0312:Lrp1b UTSW 2 41282171 missense probably damaging 1.00
R0325:Lrp1b UTSW 2 40851711 missense probably damaging 1.00
R0330:Lrp1b UTSW 2 40701761 nonsense probably null
R0372:Lrp1b UTSW 2 40730798 missense probably benign 0.30
R0400:Lrp1b UTSW 2 40750914 missense probably benign 0.40
R0408:Lrp1b UTSW 2 40677591 missense probably damaging 1.00
R0498:Lrp1b UTSW 2 41458405 missense probably benign 0.19
R0563:Lrp1b UTSW 2 40750914 missense probably benign 0.40
R0569:Lrp1b UTSW 2 40889239 missense probably benign 0.11
R0622:Lrp1b UTSW 2 41728551 critical splice donor site probably null
R0682:Lrp1b UTSW 2 41295641 missense probably benign 0.01
R0727:Lrp1b UTSW 2 40750944 missense probably benign 0.40
R0747:Lrp1b UTSW 2 40870341 missense probably damaging 1.00
R0761:Lrp1b UTSW 2 41185935 missense probably damaging 0.99
R0905:Lrp1b UTSW 2 41284185 missense probably damaging 1.00
R0959:Lrp1b UTSW 2 41268354 missense possibly damaging 0.83
R1124:Lrp1b UTSW 2 40875051 missense probably damaging 1.00
R1158:Lrp1b UTSW 2 40677494 missense unknown
R1265:Lrp1b UTSW 2 41476654 missense probably damaging 1.00
R1276:Lrp1b UTSW 2 41728576 missense probably benign 0.35
R1277:Lrp1b UTSW 2 40725945 missense probably benign
R1282:Lrp1b UTSW 2 40860761 missense probably damaging 1.00
R1291:Lrp1b UTSW 2 41341895 missense probably benign 0.05
R1316:Lrp1b UTSW 2 40702804 missense probably benign
R1340:Lrp1b UTSW 2 40702794 missense probably benign 0.02
R1371:Lrp1b UTSW 2 40647153 missense probably damaging 1.00
R1415:Lrp1b UTSW 2 40629664 missense probably damaging 1.00
R1416:Lrp1b UTSW 2 40998216 missense probably damaging 1.00
R1417:Lrp1b UTSW 2 41004641 missense probably benign 0.14
R1465:Lrp1b UTSW 2 41111059 missense probably benign 0.00
R1465:Lrp1b UTSW 2 41111059 missense probably benign 0.00
R1467:Lrp1b UTSW 2 40657356 splice site probably benign
R1468:Lrp1b UTSW 2 40927829 critical splice donor site probably null
R1468:Lrp1b UTSW 2 40927829 critical splice donor site probably null
R1480:Lrp1b UTSW 2 40903389 missense probably damaging 1.00
R1488:Lrp1b UTSW 2 41502024 missense probably benign 0.01
R1496:Lrp1b UTSW 2 42323662 missense probably damaging 0.98
R1542:Lrp1b UTSW 2 41123712 missense probably damaging 1.00
R1571:Lrp1b UTSW 2 41476646 missense probably damaging 1.00
R1598:Lrp1b UTSW 2 41511478 missense probably damaging 1.00
R1619:Lrp1b UTSW 2 40697589 missense unknown
R1697:Lrp1b UTSW 2 40822683 missense probably damaging 0.99
R1698:Lrp1b UTSW 2 40851806 nonsense probably null
R1699:Lrp1b UTSW 2 41185962 missense possibly damaging 0.91
R1715:Lrp1b UTSW 2 41185981 missense probably damaging 1.00
R1748:Lrp1b UTSW 2 41728706 missense possibly damaging 0.56
R1756:Lrp1b UTSW 2 41110825 missense probably damaging 1.00
R1889:Lrp1b UTSW 2 40919167 nonsense probably null
R1895:Lrp1b UTSW 2 40665147 missense unknown
R1919:Lrp1b UTSW 2 41728729 missense probably benign 0.00
R1939:Lrp1b UTSW 2 40697589 missense unknown
R1946:Lrp1b UTSW 2 40665147 missense unknown
R1954:Lrp1b UTSW 2 40858441 missense probably damaging 1.00
R1970:Lrp1b UTSW 2 40875069 missense probably damaging 1.00
R1983:Lrp1b UTSW 2 41511404 critical splice donor site probably null
R2029:Lrp1b UTSW 2 41341849 missense probably benign 0.02
R2054:Lrp1b UTSW 2 40697482 missense unknown
R2108:Lrp1b UTSW 2 41110757 missense probably damaging 1.00
R2158:Lrp1b UTSW 2 40879555 missense probably benign 0.00
R2168:Lrp1b UTSW 2 41375846 missense probably damaging 1.00
R2184:Lrp1b UTSW 2 40730702 missense probably benign
R2188:Lrp1b UTSW 2 41408959 missense probably benign 0.25
R2200:Lrp1b UTSW 2 41284165 missense probably benign 0.43
R2342:Lrp1b UTSW 2 40919196 missense possibly damaging 0.89
R2421:Lrp1b UTSW 2 40882133 splice site probably benign
R2656:Lrp1b UTSW 2 41511581 missense probably damaging 0.99
R2864:Lrp1b UTSW 2 40874995 missense possibly damaging 0.92
R2874:Lrp1b UTSW 2 40851693 missense probably damaging 1.00
R2911:Lrp1b UTSW 2 41506692 missense probably benign 0.00
R2919:Lrp1b UTSW 2 41770899 missense probably damaging 1.00
R3027:Lrp1b UTSW 2 40870271 missense probably benign 0.33
R3083:Lrp1b UTSW 2 40600324 missense probably damaging 0.99
R3545:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3546:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3547:Lrp1b UTSW 2 40600288 missense probably damaging 1.00
R3709:Lrp1b UTSW 2 40697442 missense unknown
R3817:Lrp1b UTSW 2 40876658 missense probably damaging 1.00
R3876:Lrp1b UTSW 2 41445194 missense probably damaging 1.00
R3877:Lrp1b UTSW 2 41445194 missense probably damaging 1.00
R3896:Lrp1b UTSW 2 40922428 splice site probably null
R3901:Lrp1b UTSW 2 40822695 missense probably damaging 1.00
R3915:Lrp1b UTSW 2 41449236 missense probably damaging 1.00
R3922:Lrp1b UTSW 2 40677581 missense unknown
R3964:Lrp1b UTSW 2 41312470 splice site probably benign
R4013:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4014:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4015:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4017:Lrp1b UTSW 2 40802984 missense possibly damaging 0.66
R4031:Lrp1b UTSW 2 40702848 missense probably benign 0.00
R4095:Lrp1b UTSW 2 41449191 missense probably benign 0.03
R4108:Lrp1b UTSW 2 40665087 missense unknown
R4176:Lrp1b UTSW 2 41408393 missense probably damaging 1.00
R4181:Lrp1b UTSW 2 40611434 missense probably damaging 1.00
R4359:Lrp1b UTSW 2 40903065 missense probably damaging 1.00
R4410:Lrp1b UTSW 2 40665082 missense possibly damaging 0.96
R4416:Lrp1b UTSW 2 40663667 missense unknown
R4489:Lrp1b UTSW 2 40661489 unclassified probably benign
R4577:Lrp1b UTSW 2 40821719 missense probably damaging 1.00
R4623:Lrp1b UTSW 2 41246021 missense probably damaging 1.00
R4677:Lrp1b UTSW 2 40801484 missense probably damaging 1.00
R4684:Lrp1b UTSW 2 40922304 missense probably benign 0.44
R4714:Lrp1b UTSW 2 41110759 missense possibly damaging 0.90
R4721:Lrp1b UTSW 2 40715369 splice site probably null
R4755:Lrp1b UTSW 2 41269273 missense probably benign 0.07
R4755:Lrp1b UTSW 2 41471016 missense probably benign
R4774:Lrp1b UTSW 2 40661532 missense probably null 1.00
R4854:Lrp1b UTSW 2 41111077 missense probably damaging 1.00
R4880:Lrp1b UTSW 2 41770919 missense probably benign 0.07
R4885:Lrp1b UTSW 2 41468893 missense probably benign
R4901:Lrp1b UTSW 2 40821645 missense probably damaging 1.00
R4919:Lrp1b UTSW 2 40647234 missense probably benign 0.25
R4935:Lrp1b UTSW 2 41498393 missense probably benign 0.01
R4937:Lrp1b UTSW 2 40802885 splice site probably null
R4967:Lrp1b UTSW 2 41788974 missense probably damaging 1.00
R4968:Lrp1b UTSW 2 40702707 splice site probably null
R4968:Lrp1b UTSW 2 41789062 missense probably damaging 1.00
R5155:Lrp1b UTSW 2 41728622 intron probably null
R5221:Lrp1b UTSW 2 41112982 missense possibly damaging 0.79
R5224:Lrp1b UTSW 2 41110840 missense possibly damaging 0.61
R5227:Lrp1b UTSW 2 40851793 missense possibly damaging 0.95
R5246:Lrp1b UTSW 2 41470940 critical splice donor site probably null
R5263:Lrp1b UTSW 2 41960679 missense probably damaging 1.00
R5274:Lrp1b UTSW 2 41344444 missense probably null 1.00
R5291:Lrp1b UTSW 2 40903003 missense probably damaging 1.00
R5362:Lrp1b UTSW 2 41375902 missense probably damaging 1.00
R5365:Lrp1b UTSW 2 40647125 missense possibly damaging 0.55
R5369:Lrp1b UTSW 2 41004613 nonsense probably null
R5419:Lrp1b UTSW 2 40730704 nonsense probably null
R5434:Lrp1b UTSW 2 41770868 missense probably damaging 0.96
R5452:Lrp1b UTSW 2 40922316 missense probably damaging 1.00
R5453:Lrp1b UTSW 2 41282237 missense probably damaging 1.00
R5496:Lrp1b UTSW 2 40927973 missense probably benign 0.02
R5524:Lrp1b UTSW 2 41110888 missense probably damaging 1.00
R5538:Lrp1b UTSW 2 40697474 missense unknown
R5571:Lrp1b UTSW 2 41408342 missense probably damaging 0.97
R5577:Lrp1b UTSW 2 40875123 missense possibly damaging 0.70
R5609:Lrp1b UTSW 2 41341795 missense probably damaging 1.00
R5635:Lrp1b UTSW 2 42652822 utr 5 prime probably benign
R5669:Lrp1b UTSW 2 41111038 missense probably damaging 1.00
R5672:Lrp1b UTSW 2 41341759 missense probably benign 0.01
R5690:Lrp1b UTSW 2 40750894 splice site probably null
R5752:Lrp1b UTSW 2 41295612 missense probably damaging 1.00
R5853:Lrp1b UTSW 2 40663726 missense unknown
R5869:Lrp1b UTSW 2 41004603 missense probably damaging 0.98
R5880:Lrp1b UTSW 2 41341814 missense probably benign 0.23
R5887:Lrp1b UTSW 2 40821707 missense possibly damaging 0.91
R5893:Lrp1b UTSW 2 40601587 missense probably damaging 1.00
R5894:Lrp1b UTSW 2 41498221 missense probably benign 0.11
R6019:Lrp1b UTSW 2 41302970 missense probably damaging 1.00
R6019:Lrp1b UTSW 2 41476809 missense probably damaging 1.00
R6021:Lrp1b UTSW 2 41344427 missense probably benign 0.02
R6045:Lrp1b UTSW 2 40701813 missense unknown
R6047:Lrp1b UTSW 2 40637775 missense probably benign 0.00
R6060:Lrp1b UTSW 2 40750934 missense probably benign 0.09
R6063:Lrp1b UTSW 2 41284144 nonsense probably null
R6090:Lrp1b UTSW 2 41185868 critical splice donor site probably null
R6112:Lrp1b UTSW 2 41341882 missense probably benign 0.14
R6128:Lrp1b UTSW 2 40860655 missense probably benign
R6149:Lrp1b UTSW 2 40875153 splice site probably null
R6174:Lrp1b UTSW 2 41449263 missense probably benign
R6177:Lrp1b UTSW 2 41123736 splice site probably null
R6257:Lrp1b UTSW 2 40596969 unclassified probably null
R6267:Lrp1b UTSW 2 40657525 missense probably benign 0.00
R6268:Lrp1b UTSW 2 40821717 missense probably benign 0.01
R6331:Lrp1b UTSW 2 40803209 missense probably damaging 1.00
R6334:Lrp1b UTSW 2 41789033 missense probably benign
R6359:Lrp1b UTSW 2 41295596 missense probably damaging 1.00
R6371:Lrp1b UTSW 2 40851654 missense possibly damaging 0.61
R6421:Lrp1b UTSW 2 40889270 missense probably damaging 1.00
R6524:Lrp1b UTSW 2 40851804 missense possibly damaging 0.95
R6616:Lrp1b UTSW 2 40699631 missense unknown
R6632:Lrp1b UTSW 2 40725442 missense probably benign 0.23
R6656:Lrp1b UTSW 2 40637864 nonsense probably null
R6698:Lrp1b UTSW 2 41302946 missense probably damaging 1.00
R6741:Lrp1b UTSW 2 41245989 missense possibly damaging 0.82
R6742:Lrp1b UTSW 2 41471120 missense probably benign 0.31
R6811:Lrp1b UTSW 2 40715500 splice site probably null
R6811:Lrp1b UTSW 2 41449194 missense probably benign 0.01
R6855:Lrp1b UTSW 2 40628696 missense possibly damaging 0.66
R6888:Lrp1b UTSW 2 41471126 missense probably benign 0.18
R6946:Lrp1b UTSW 2 40697439 missense probably benign
R6984:Lrp1b UTSW 2 40822628 missense probably damaging 0.97
V1662:Lrp1b UTSW 2 41122932 missense probably damaging 0.99
X0028:Lrp1b UTSW 2 41471145 missense probably damaging 1.00
X0064:Lrp1b UTSW 2 41502043 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCGTTCAACTATTTCCAAC -3'
(R):5'- GATGGTGATTTCTCTGGATGCTAAAC -3'

Sequencing Primer
(F):5'- CCAACTAAGTAAATTTTAGGAGT -3'
(R):5'- TGGATGCTAAACATTAGAAAGAATCC -3'
Posted On2014-06-30