Incidental Mutation 'R1902:Pde3a'
ID212332
Institutional Source Beutler Lab
Gene Symbol Pde3a
Ensembl Gene ENSMUSG00000041741
Gene Namephosphodiesterase 3A, cGMP inhibited
SynonymsA930022O17Rik
MMRRC Submission 039922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R1902 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location141249269-141507448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 141498770 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1101 (N1101K)
Ref Sequence ENSEMBL: ENSMUSP00000038749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043259]
Predicted Effect probably benign
Transcript: ENSMUST00000043259
AA Change: N1101K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: N1101K

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 103 121 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
low complexity region 419 445 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
HDc 749 964 3.76e-4 SMART
low complexity region 1028 1056 N/A INTRINSIC
low complexity region 1114 1133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 128 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik C T 12: 18,534,003 Q355* probably null Het
Acacb A T 5: 114,165,734 R73* probably null Het
Adra1a T C 14: 66,638,235 S220P probably benign Het
Ano2 A T 6: 125,872,684 E126D probably damaging Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arhgap45 C A 10: 80,025,466 Q488K probably damaging Het
Arhgef7 C A 8: 11,808,713 probably null Het
Atxn7l3b A G 10: 112,928,673 I17T probably benign Het
BC003331 T A 1: 150,388,609 probably null Het
Bpifb9a A T 2: 154,261,991 N118I probably benign Het
Btbd9 A T 17: 30,530,228 D37E probably damaging Het
C8a T C 4: 104,856,601 probably null Het
Capn13 G A 17: 73,326,361 S535F probably damaging Het
Carns1 G T 19: 4,166,338 P615Q probably damaging Het
Casz1 T C 4: 148,936,195 I479T possibly damaging Het
Ccdc88a G T 11: 29,461,788 M532I probably benign Het
Cdc42bpb T G 12: 111,326,016 S362R probably damaging Het
Ceacam11 A T 7: 17,975,327 H150L probably benign Het
Cfap44 A C 16: 44,422,374 T714P probably benign Het
Cnot1 T C 8: 95,743,121 I1369V possibly damaging Het
Cpeb1 T C 7: 81,372,119 D92G probably benign Het
Cped1 T A 6: 22,120,981 probably null Het
Csf1r A G 18: 61,130,141 T896A probably damaging Het
Csf3r T C 4: 126,042,918 F658S probably damaging Het
Cts6 A T 13: 61,201,515 Y126* probably null Het
Cul7 T C 17: 46,655,740 L365P probably damaging Het
Cxcl5 T C 5: 90,759,785 V72A probably damaging Het
Cyp4v3 T A 8: 45,306,952 H521L probably benign Het
Dct T C 14: 118,034,278 N380S probably benign Het
Dnah1 T C 14: 31,319,759 D85G probably damaging Het
Dnah7a T C 1: 53,535,478 D1709G probably damaging Het
Dnaic1 A T 4: 41,625,319 K428* probably null Het
Dsc1 A T 18: 20,095,988 V415D probably damaging Het
E2f8 T C 7: 48,871,172 H467R probably benign Het
Eddm3b T A 14: 51,116,864 I103N probably damaging Het
Fam71b A T 11: 46,407,011 T381S probably benign Het
Gal3st2c T G 1: 94,008,889 N185K probably damaging Het
Ganc T C 2: 120,446,482 L675P probably damaging Het
Gdf9 G A 11: 53,436,953 M245I probably benign Het
Gm21886 G A 18: 80,089,418 T175I probably damaging Het
Gria2 A G 3: 80,722,108 L269P probably damaging Het
Grm8 T C 6: 27,429,482 Y471C probably damaging Het
Gucy2g T A 19: 55,210,237 T825S probably benign Het
H2-Bl A T 17: 36,083,953 M16K probably damaging Het
Iffo2 T C 4: 139,607,701 S124P probably damaging Het
Igf1r T C 7: 68,201,249 Y931H possibly damaging Het
Il22ra1 A T 4: 135,750,908 Q430L probably damaging Het
Il23r A C 6: 67,423,734 D537E probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Itgb4 T C 11: 115,980,738 V179A probably damaging Het
Itpr2 T A 6: 146,229,703 H1968L probably damaging Het
Kdm4a A G 4: 118,160,399 V490A probably benign Het
Kif13a A T 13: 46,788,162 D946E probably benign Het
Klhl22 T A 16: 17,771,787 I104N probably damaging Het
Klk6 A C 7: 43,826,057 M1L probably benign Het
Krt78 A T 15: 101,946,963 C804* probably null Het
Larp7 A T 3: 127,540,578 N533K probably damaging Het
Lrit3 T C 3: 129,791,246 T288A probably benign Het
Lrp11 T A 10: 7,623,780 L245Q probably damaging Het
Lrp1b T C 2: 40,860,661 S2964G probably damaging Het
Lrrc66 C T 5: 73,607,622 V693M probably damaging Het
Macf1 T A 4: 123,471,165 M3268L probably benign Het
Mad1l1 A G 5: 140,303,688 S161P possibly damaging Het
Mettl25 A G 10: 105,826,087 S341P probably damaging Het
Morc3 A G 16: 93,870,497 T588A probably damaging Het
Mospd3 A G 5: 137,600,415 S21P probably damaging Het
Mrpl57 T A 14: 57,826,729 F71L probably damaging Het
Mtbp T C 15: 55,606,715 L594S probably damaging Het
Mthfd2 T C 6: 83,306,731 N323S probably damaging Het
Muc5b G T 7: 141,864,105 S3596I possibly damaging Het
Mug1 A G 6: 121,881,821 D1166G probably benign Het
Nav1 T G 1: 135,472,410 N474T probably benign Het
Ncoa1 A T 12: 4,339,049 D75E possibly damaging Het
Ncor1 A C 11: 62,338,158 I958S probably damaging Het
Nefm T C 14: 68,124,114 S234G probably benign Het
Nlrp4c T C 7: 6,065,819 S240P probably damaging Het
Nox3 C T 17: 3,670,017 V298M probably damaging Het
Ntn4 A G 10: 93,707,372 D320G possibly damaging Het
Nudt13 C G 14: 20,310,641 T174R probably damaging Het
Olfr1002 T C 2: 85,647,857 S155G possibly damaging Het
Olfr119 T A 17: 37,701,421 H250Q probably damaging Het
Olfr1245 A T 2: 89,575,603 L41Q possibly damaging Het
Olfr1512 T G 14: 52,372,717 Q112P possibly damaging Het
Olfr209 A T 16: 59,362,163 D18E probably benign Het
Olfr355 T C 2: 36,927,185 I310V probably benign Het
Olfr430 T C 1: 174,070,126 V276A probably damaging Het
Olfr437 T A 6: 43,167,723 probably null Het
Olfr812 G T 10: 129,842,506 P179T probably benign Het
Olfr967 T C 9: 39,750,806 V140A probably benign Het
Opn1sw T A 6: 29,379,804 N144Y possibly damaging Het
Osbpl5 T C 7: 143,703,181 D404G possibly damaging Het
Parp14 C T 16: 35,853,518 probably null Het
Plcb1 G A 2: 134,813,613 V38I possibly damaging Het
Plec T A 15: 76,175,551 E3417D probably damaging Het
Ppfibp2 C T 7: 107,746,378 P869L probably damaging Het
Ppp1r12a T A 10: 108,198,891 I99N probably damaging Het
Pramel5 G A 4: 144,273,863 Q48* probably null Het
Prr13 C A 15: 102,460,698 probably benign Het
Psg22 T A 7: 18,724,438 Y312* probably null Het
Ptchd4 A T 17: 42,503,616 I803L probably benign Het
Rasa4 A G 5: 136,091,238 D56G probably benign Het
Rif1 T A 2: 52,116,673 N2206K possibly damaging Het
Robo1 A G 16: 72,960,204 Q351R probably null Het
Samd4 T C 14: 47,074,128 F81S probably damaging Het
Sh3pxd2b T C 11: 32,423,559 *909Q probably null Het
Slc25a45 A G 19: 5,884,522 R173G probably damaging Het
Smarca1 G A X: 47,849,963 Q723* probably null Het
Smoc1 T C 12: 81,104,671 I54T probably benign Het
Spef2 G T 15: 9,607,377 R1319S probably damaging Het
Steap3 T G 1: 120,241,734 I240L probably benign Het
Stmn4 C T 14: 66,355,609 L13F probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Syt3 T C 7: 44,390,516 S58P possibly damaging Het
Tas2r125 T C 6: 132,910,176 F176L probably benign Het
Tbc1d19 T A 5: 53,829,353 C35S probably benign Het
Tcaf3 T C 6: 42,593,552 E422G possibly damaging Het
Tekt4 T A 17: 25,471,858 F46Y possibly damaging Het
Tnfaip3 T C 10: 19,008,189 K148E probably benign Het
Trrap T G 5: 144,816,053 I1813R probably damaging Het
Ttc29 A G 8: 78,251,732 E137G probably benign Het
Tubgcp6 C A 15: 89,116,241 R307L possibly damaging Het
Tyro3 T C 2: 119,801,695 I81T possibly damaging Het
Upp2 T G 2: 58,771,452 M71R probably damaging Het
Utp20 G T 10: 88,753,026 T2427K probably benign Het
Vcl T A 14: 20,982,699 L122Q probably damaging Het
Vmn1r213 A C 13: 23,012,306 N353T possibly damaging Het
Vwa5b2 G T 16: 20,604,832 S1165I possibly damaging Het
Zfp869 T C 8: 69,707,438 K162E probably benign Het
Other mutations in Pde3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Pde3a APN 6 141459738 missense probably damaging 1.00
IGL01400:Pde3a APN 6 141459228 missense probably benign 0.02
IGL01752:Pde3a APN 6 141487613 splice site probably benign
IGL01819:Pde3a APN 6 141487537 missense probably damaging 1.00
IGL02014:Pde3a APN 6 141459144 missense probably null 1.00
IGL02119:Pde3a APN 6 141459803 missense probably damaging 0.97
IGL02465:Pde3a APN 6 141249675 missense possibly damaging 0.53
IGL02677:Pde3a APN 6 141405172 splice site probably benign
IGL02961:Pde3a APN 6 141459700 nonsense probably null
IGL03034:Pde3a APN 6 141492400 splice site probably benign
IGL03142:Pde3a APN 6 141492299 missense probably benign 0.01
R0412:Pde3a UTSW 6 141498684 missense probably damaging 1.00
R0517:Pde3a UTSW 6 141498657 nonsense probably null
R0573:Pde3a UTSW 6 141492231 missense probably damaging 1.00
R0621:Pde3a UTSW 6 141249999 missense probably damaging 1.00
R0781:Pde3a UTSW 6 141459316 splice site probably benign
R1065:Pde3a UTSW 6 141476732 splice site probably benign
R1110:Pde3a UTSW 6 141459316 splice site probably benign
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1480:Pde3a UTSW 6 141487574 missense probably benign 0.17
R1559:Pde3a UTSW 6 141459098 missense probably damaging 1.00
R1862:Pde3a UTSW 6 141250353 missense probably damaging 1.00
R1862:Pde3a UTSW 6 141487513 missense probably damaging 1.00
R1909:Pde3a UTSW 6 141250239 missense probably benign 0.00
R2048:Pde3a UTSW 6 141489006 splice site probably benign
R2144:Pde3a UTSW 6 141490111 missense probably benign 0.40
R2155:Pde3a UTSW 6 141483914 missense possibly damaging 0.70
R2208:Pde3a UTSW 6 141250347 missense probably damaging 0.97
R2405:Pde3a UTSW 6 141481242 missense probably damaging 1.00
R4592:Pde3a UTSW 6 141459216 missense probably benign 0.13
R4677:Pde3a UTSW 6 141466139 missense probably benign 0.02
R4803:Pde3a UTSW 6 141459086 missense probably damaging 1.00
R4887:Pde3a UTSW 6 141470942 missense possibly damaging 0.94
R4999:Pde3a UTSW 6 141250025 missense probably benign 0.00
R5055:Pde3a UTSW 6 141487956 nonsense probably null
R5181:Pde3a UTSW 6 141481255 critical splice donor site probably null
R5640:Pde3a UTSW 6 141483915 missense probably damaging 0.99
R5694:Pde3a UTSW 6 141250502 missense possibly damaging 0.48
R6176:Pde3a UTSW 6 141498889 missense possibly damaging 0.96
R6394:Pde3a UTSW 6 141487511 missense probably damaging 1.00
R6692:Pde3a UTSW 6 141479346 missense probably damaging 1.00
R6968:Pde3a UTSW 6 141487932 missense probably damaging 1.00
R7137:Pde3a UTSW 6 141498746 missense not run
X0053:Pde3a UTSW 6 141483969 splice site probably null
X0062:Pde3a UTSW 6 141249984 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCACTAAAGCAACTGAGATAG -3'
(R):5'- AGACGAGTCATTCTGTCTGC -3'

Sequencing Primer
(F):5'- CTAAAGCAACTGAGATAGGCAAAC -3'
(R):5'- GAGTCATTCTGTCTGCAAACACAG -3'
Posted On2014-06-30