Incidental Mutation 'R0124:Tfap2a'
ID21237
Institutional Source Beutler Lab
Gene Symbol Tfap2a
Ensembl Gene ENSMUSG00000021359
Gene Nametranscription factor AP-2, alpha
SynonymsTcfap2a, Ap2, Ap-2 (a), AP-2 alpha, Ap2tf, AP2alpha
MMRRC Submission 038409-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0124 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location40715302-40738376 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 40717411 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153271 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021787] [ENSMUST00000110193] [ENSMUST00000223869] [ENSMUST00000224665] [ENSMUST00000224999] [ENSMUST00000225180]
Predicted Effect probably benign
Transcript: ENSMUST00000021787
SMART Domains Protein: ENSMUSP00000021787
Gene: ENSMUSG00000021359

DomainStartEndE-ValueType
low complexity region 46 68 N/A INTRINSIC
low complexity region 82 95 N/A INTRINSIC
low complexity region 126 142 N/A INTRINSIC
Pfam:TF_AP-2 201 408 1.6e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110193
SMART Domains Protein: ENSMUSP00000105822
Gene: ENSMUSG00000021359

DomainStartEndE-ValueType
low complexity region 52 74 N/A INTRINSIC
low complexity region 88 101 N/A INTRINSIC
low complexity region 132 148 N/A INTRINSIC
Pfam:TF_AP-2 209 409 7.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224319
Predicted Effect probably benign
Transcript: ENSMUST00000224665
Predicted Effect probably benign
Transcript: ENSMUST00000224999
Predicted Effect probably benign
Transcript: ENSMUST00000225180
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.7%
  • 20x: 89.8%
Validation Efficiency 100% (67/67)
MGI Phenotype FUNCTION: This gene is a member of the activator protein 2 (AP-2) transcription factor family. The protein encoded by this gene can act as both an activator and repressor of gene transcription, and plays an important role in early embryogenesis, specifically in cranial development. This protein forms both homodimers and heterodimers, and binds to a GC-rich consensus sequence found in some promoters and enhancers. Disruption of this gene causes perinatal death, with neural tube, craniofacial, and limb mesenchyme defects. Alternative splicing results in multiple transcript variants that encode multiple protein isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mutants die perinatally with anencephaly, craniofacial and neural tube defects, thoraco-abdominoschisis and defects in sensory organs, cranial ganglia, skeleton, and heart. On some genetic backgrounds, heterozygotes may exhibit exencephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003E16Rik A G 6: 83,161,674 T194A probably benign Het
Afap1 C T 5: 35,945,209 P82S probably damaging Het
Ankrd28 A G 14: 31,727,741 Y481H probably damaging Het
Arid1b C T 17: 5,339,330 T1717I probably damaging Het
Atad2b A G 12: 4,952,676 K348R probably benign Het
B020004J07Rik A G 4: 101,835,373 *477Q probably null Het
Bcl3 C T 7: 19,809,651 V5M probably damaging Het
C2cd3 A G 7: 100,469,518 E2321G probably benign Het
Casq1 C T 1: 172,210,425 V380M probably damaging Het
Cd209e T A 8: 3,851,274 T127S probably benign Het
Cdh23 G T 10: 60,308,056 Y2921* probably null Het
Cdh6 A G 15: 13,034,324 L750P probably damaging Het
Cdk12 T C 11: 98,211,247 probably benign Het
Ces5a T C 8: 93,528,555 E170G probably damaging Het
Clec4f A G 6: 83,652,353 probably null Het
Col19a1 T C 1: 24,526,458 N264S unknown Het
Col2a1 T A 15: 97,998,862 I43F unknown Het
Col4a2 A G 8: 11,408,871 probably benign Het
Csmd3 T A 15: 47,590,716 D3578V probably damaging Het
Cyp2c37 T C 19: 39,994,102 L128P probably damaging Het
Dysf A G 6: 84,065,102 probably benign Het
Eml1 T C 12: 108,506,608 V225A probably benign Het
Eml1 A G 12: 108,509,178 Y256C probably damaging Het
Epb41l5 T A 1: 119,633,640 K64* probably null Het
Fat2 A G 11: 55,283,678 F2070L probably damaging Het
Fbxw18 G T 9: 109,691,515 H259N probably benign Het
Gm10764 A T 10: 87,290,748 T6S unknown Het
Gm14412 A G 2: 177,315,912 probably benign Het
Heatr5b A T 17: 78,826,217 probably benign Het
Hid1 T C 11: 115,356,823 T250A probably damaging Het
Hnf4g A G 3: 3,643,082 probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Lrriq1 C T 10: 103,170,420 probably null Het
Map3k13 A G 16: 21,903,756 T223A possibly damaging Het
Matn2 C T 15: 34,426,151 probably benign Het
Myo6 A G 9: 80,307,774 E1253G probably damaging Het
Nomo1 G T 7: 46,083,228 probably benign Het
Olfr1221 A T 2: 89,111,744 I256K possibly damaging Het
Olfr160 A G 9: 37,711,463 V272A possibly damaging Het
Olfr356 A T 2: 36,937,256 I46F possibly damaging Het
Papolg C T 11: 23,867,535 A582T probably benign Het
Plekhm3 C T 1: 64,921,751 E449K probably damaging Het
Pole T G 5: 110,303,992 M900R probably damaging Het
Ppp1cb T A 5: 32,483,478 probably benign Het
Pros1 A G 16: 62,913,946 T372A possibly damaging Het
Scara3 A T 14: 65,931,221 S316T probably benign Het
St5 A G 7: 109,542,511 S132P possibly damaging Het
Stau2 C T 1: 16,463,128 A61T probably damaging Het
Stx3 T C 19: 11,791,799 E54G possibly damaging Het
Sun1 T C 5: 139,246,679 probably benign Het
Swt1 A T 1: 151,391,529 C634S probably damaging Het
Syt6 A G 3: 103,587,526 Y269C probably damaging Het
Tmx4 A T 2: 134,639,720 probably null Het
Ttc39d T C 17: 80,216,946 C345R probably damaging Het
Vmn1r27 T C 6: 58,215,248 Y257C probably damaging Het
Vmn2r27 T A 6: 124,231,619 T56S probably benign Het
Vps13b T C 15: 35,576,528 probably null Het
Wdr17 A G 8: 54,635,491 S1175P probably damaging Het
Wsb2 T C 5: 117,363,758 F63L probably benign Het
Zfp142 A G 1: 74,568,623 Y1561H probably damaging Het
Other mutations in Tfap2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4366001:Tfap2a UTSW 13 40721374 missense possibly damaging 0.67
R0400:Tfap2a UTSW 13 40717412 splice site probably benign
R0486:Tfap2a UTSW 13 40728694 missense probably damaging 1.00
R1132:Tfap2a UTSW 13 40721391 splice site probably null
R1418:Tfap2a UTSW 13 40717204 missense possibly damaging 0.89
R1751:Tfap2a UTSW 13 40725137 missense probably damaging 1.00
R1767:Tfap2a UTSW 13 40725137 missense probably damaging 1.00
R1802:Tfap2a UTSW 13 40725170 missense probably damaging 1.00
R1865:Tfap2a UTSW 13 40728408 missense probably damaging 1.00
R4913:Tfap2a UTSW 13 40717230 missense probably damaging 1.00
R5764:Tfap2a UTSW 13 40728355 missense possibly damaging 0.64
R6378:Tfap2a UTSW 13 40723241 missense possibly damaging 0.48
R6496:Tfap2a UTSW 13 40728775 missense probably damaging 1.00
R6751:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6773:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6774:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R6786:Tfap2a UTSW 13 40728754 missense probably damaging 1.00
R7027:Tfap2a UTSW 13 40733674 missense probably benign 0.02
R7140:Tfap2a UTSW 13 40730047 missense probably benign 0.19
R7268:Tfap2a UTSW 13 40728760 missense possibly damaging 0.91
R7299:Tfap2a UTSW 13 40721308 missense probably damaging 1.00
R7301:Tfap2a UTSW 13 40721308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCCTCGGTGAGATAGTTCTGC -3'
(R):5'- TGAGAGGAGACCCCATTCCACCAG -3'

Sequencing Primer
(F):5'- CAGGGCCGTAACCGCTG -3'
(R):5'- TGAAGAACAAGCCTGGCATTTC -3'
Posted On2013-04-11