Incidental Mutation 'R0664:Prmt5'
ID212446
Institutional Source Beutler Lab
Gene Symbol Prmt5
Ensembl Gene ENSMUSG00000023110
Gene Nameprotein arginine N-methyltransferase 5
SynonymsJak-binding protein 1, Jbp1, Skb1
MMRRC Submission 038849-MU
Accession Numbers

Genbank: NM_013768.3; Ensembl: ENSMUST00000023873

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0664 (G1)
Quality Score59
Status Validated
Chromosome14
Chromosomal Location54507187-54517525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 54507856 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 618 (T618K)
Ref Sequence ENSEMBL: ENSMUSP00000023873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023873] [ENSMUST00000132227]
Predicted Effect probably damaging
Transcript: ENSMUST00000023873
AA Change: T618K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023873
Gene: ENSMUSG00000023110
AA Change: T618K

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
Pfam:PRMT5 181 619 4.5e-184 PFAM
Pfam:SAMBD 184 465 3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132227
SMART Domains Protein: ENSMUSP00000138549
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
low complexity region 1 18 N/A INTRINSIC
PDB:4GQB|A 19 40 5e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000139964
SMART Domains Protein: ENSMUSP00000121502
Gene: ENSMUSG00000023110

DomainStartEndE-ValueType
Pfam:PRMT5 1 62 1.3e-10 PFAM
Pfam:SAMBD 1 203 4.6e-68 PFAM
Pfam:PRMT5 52 203 1.2e-56 PFAM
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: This gene encodes an enzyme that belongs to the methyltransferase family. The encoded protein catalyzes the transfer of methyl groups to the amino acid arginine, in target proteins that include histones, transcriptional elongation factors and the tumor suppressor p53. This gene plays a role in several cellular processes, including transcriptional regulation and the assembly of small nuclear ribonucleoproteins. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a null allele display embryonic lethality before somite formation with failure of inner cell mass proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(4) Gene trapped(5)

Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
A530064D06Rik T C 17: 48,166,591 I53V probably benign Het
Agmo A T 12: 37,252,572 H136L probably damaging Het
B020004C17Rik G A 14: 57,016,768 R116H possibly damaging Het
Btbd11 G A 10: 85,388,370 A348T possibly damaging Het
Cacna1b A G 2: 24,654,446 S1243P probably damaging Het
Champ1 G A 8: 13,879,485 V548M probably damaging Het
Dnah7b A T 1: 46,324,842 M3541L probably damaging Het
Emc9 A G 14: 55,581,908 L138P possibly damaging Het
Epcam T A 17: 87,639,970 Y51N possibly damaging Het
Gpr55 A T 1: 85,941,017 S281T probably benign Het
Grid2ip T A 5: 143,363,977 probably null Het
Hgfac G T 5: 35,048,178 V601F probably benign Het
Hlcs A G 16: 94,231,311 W545R probably damaging Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Ipo8 A T 6: 148,800,213 L466I probably benign Het
Jcad A G 18: 4,676,063 D1275G probably damaging Het
Mdn1 G T 4: 32,768,011 E5315* probably null Het
Nfam1 T C 15: 83,014,938 T176A probably damaging Het
Nsd3 T C 8: 25,714,240 F432S probably damaging Het
Olfr1183 C T 2: 88,462,171 P296L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Serpinb7 A G 1: 107,428,307 D20G probably damaging Het
Slco1a4 T C 6: 141,812,741 I515V probably benign Het
Stk26 T A X: 50,887,926 Y283* probably null Het
Tanc1 A T 2: 59,843,884 K1778* probably null Het
Thada A G 17: 84,336,829 L1288P probably damaging Het
Ttbk2 C A 2: 120,748,821 V607F probably damaging Het
Other mutations in Prmt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Prmt5 APN 14 54509877 missense probably damaging 1.00
IGL01586:Prmt5 APN 14 54509951 unclassified probably benign
IGL02063:Prmt5 APN 14 54511020 nonsense probably null
IGL02249:Prmt5 APN 14 54509865 missense probably damaging 1.00
IGL03024:Prmt5 APN 14 54516598 missense possibly damaging 0.93
skipper UTSW 14 54509911 missense probably damaging 1.00
1mM(1):Prmt5 UTSW 14 54511500 critical splice donor site probably null
R0485:Prmt5 UTSW 14 54511255 missense probably damaging 1.00
R1473:Prmt5 UTSW 14 54508915 missense probably damaging 1.00
R2106:Prmt5 UTSW 14 54507917 missense probably benign 0.00
R2159:Prmt5 UTSW 14 54515338 missense probably benign 0.03
R4728:Prmt5 UTSW 14 54507907 missense probably benign 0.00
R4843:Prmt5 UTSW 14 54516125 missense probably benign 0.33
R5261:Prmt5 UTSW 14 54507916 missense probably damaging 0.96
R5277:Prmt5 UTSW 14 54509942 missense probably benign 0.02
R5736:Prmt5 UTSW 14 54514840 missense probably null 0.84
R5892:Prmt5 UTSW 14 54509911 missense probably damaging 1.00
R5945:Prmt5 UTSW 14 54514887 missense possibly damaging 0.52
R7021:Prmt5 UTSW 14 54515388 missense probably damaging 1.00
R7091:Prmt5 UTSW 14 54511342 splice site probably null
R7172:Prmt5 UTSW 14 54514886 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGCTGCTGAGTTCTCATGCCCAAG -3'
(R):5'- GTCTGTCCCACCATCATTGCCAAG -3'

Sequencing Primer
(F):5'- tccatctgcctctgcctc -3'
(R):5'- GTACAATTCCTCATTCAAGCCG -3'
Posted On2014-07-02